Candida albicans in Faeces of Migratory Geese Can Persist in Agricultural Soils: One‐Health Implications for Grazing Livestock
Luke Woodford, Craig J. Engelbrecht, Maiken Skov, Richard S. Quilliam
TL;DR
Candida albicans from migratory geese can survive in agricultural soils, posing a risk to livestock and highlighting the need for pathogen monitoring.
Contribution
Demonstrates the viability and persistence of C. albicans in agricultural soils after being shed in migratory goose feces.
Findings
C. albicans isolates from goose feces were virulent and resistant to antifungal drugs.
C. albicans isolates from geese and sheep clustered separately in phylogenetic analysis.
C. albicans remained viable in soil for 60 days with only a one-log decline in concentration.
Abstract
The World Health Organization has classified five species of Candida as pathogens of critical concern on its recent ’Fungal Pathogen Priority List’. Candida albicans is the most common species aetiologically associated with human and animal mucosa; however, we know almost nothing about the environmental survival and the transfer pathways of C. albicans in natural environments. Here, we have isolated C. albicans from the faeces of newly arrived migratory geese in two agricultural fields in Scotland (the United Kingdom). All 14 confirmed isolates were characterised in terms of their pathogenicity (in a Galleria larval infection model) and resistance to four classes of antifungal drugs. Multilocus sequence typing (MLST) was used to assess the relatedness of these isolates with C. albicans isolated from the faeces of sheep grazing in the same field. Finally, mesocosms were used to test…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 4
Figure 5| Site | Isolate | Sample | Putative morphology | Top BLAST match | Accession number |
|---|---|---|---|---|---|
| A | CT01 | Soil |
|
| |
| A | CA01 | Goose faeces |
|
| |
| A | CA02 | Goose faeces |
|
| |
| A | CA03 | Goose faeces |
|
| |
| A | CA04 | Goose faeces |
|
| |
| A | CA05 | Goose faeces |
|
| |
| A | CA06 | Goose faeces |
|
| |
| A | CA07 | Goose faeces |
|
| |
| — | — | — | — | — | |
| B | AK01 | Goose faeces |
|
| |
| B | BR01 | Goose faeces |
|
| |
| B | MG01 | Goose faeces |
|
| |
| B | CA08 | Goose faeces |
|
| |
| B | CA09 | Goose faeces |
|
| |
| B | CA10 | Goose faeces |
|
| |
| B | CM01 | Goose faeces | — |
| |
| B | AK02 | Stover |
|
| |
| B | AK03 | Stover |
|
| |
| B | AP01 | Soil | — |
| |
| B | AK04 | Soil |
|
| |
| B | AK05 | Soil |
|
| |
| B | AP02 | Soil | — |
| |
| — | — | — | — | — | |
| AA | PK01 | Goose faeces |
|
| |
| AA | PK02 | Goose faeces |
|
| |
| AA | KM01 | Goose faeces |
|
| |
| AA | AP03 | Goose faeces | — |
| |
| AA | CA11 | Goose faeces |
|
| |
| AA | CA12 | Goose faeces |
|
| |
| AA | CA13 | Goose faeces |
|
| |
| AA | CA14 | Goose faeces |
|
| |
| AA | PK03 | Goose faeces |
|
| |
| AA | CA15 | Sheep faeces |
|
| |
| AA | CA16 | Sheep faeces |
|
| |
| AA | CA17 | Sheep faeces |
|
| |
| AA | CA18 | Sheep faeces |
|
|
- —University of Stirling10.13039/501100002326
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsMilk Quality and Mastitis in Dairy Cows · Plant-Microbe Interactions and Immunity · Helminth infection and control
1. Introduction
Several species of the yeast Candida are well‐characterised opportunistic fungal pathogens of humans and animals [1, 2] and cause an estimated 700,000 annual cases of human candidiasis [3]. Candida albicans is the most common species aetiologically associated with human and animal mucosa, although it is typically not pathogenic when in its yeast form; however, in response to certain environmental cues, it can enter its hyphal state, where it can then cause candidiasis or, in some cases, lead to invasive candidiasis and candidemia [4]. Globally, cases of Candida infections are rising concomitantly with reports of increased virulence [5] and antifungal drug resistance [6, 7]. This has led to C. albicans, together with C. auris (Candidozyma auris), Nakaseomyces glabratus (C. glabrata), C. tropicalis, C. parapsilosis and Pichia kudriavzevii (C. krusei) being placed on the WHO Priority Fungal Pathogen list [8], which was generated as a global effort to prioritise the research of high‐priority pathogens, including preventing the development of antifungal resistance.
Although the majority of research on human pathogenic Candida has been conducted in a clinical context, there are several reports of Candida being able to persist in the natural environment [9–12]. In a mesocosm study, C. albicans persisted in a range of agricultural soil types for up to 30 days [13], although persistence was determined by PCR, so it is unclear whether these particular strains of C. albicans were still viable by the end. Similarly, molecular sequencing data have been used to identify Candida in a range of other environmental matrices [14, 15]. Recently, viable multidrug‐resistant pathogenic strains of C. tropicalis and C. glabrata have been isolated from the surfaces of plastic pollution in both freshwater and marine environments, whilst the persistence and virulence of C. auris have been demonstrated in mesocosms simulating coastal and marine environments [16–18].
Candida is not generally considered to be a zoonotic pathogen [1]; however, there are concerns about the genetic relatedness of Candida isolates from animals and humans and the potential for the evolution and transmission of new variants in shared ecosystems and under climate change conditions [19, 20]. Little is known about the potential for Candida transmission, or spillover, from wild animals to livestock or humans and the risks associated with this [21]. Infections by strains of antifungal‐resistant C. albicans have been reported in both livestock [22, 23] and wild birds [24–27], including migratory birds that often land and roost in agricultural fields during migratory flights. Therefore, grazing livestock could be exposed to faeces or soil contaminated with Candida shed from migratory birds, with evidence suggesting that Candida in bird faeces can express virulence factors in similar ways to known clinical isolates, highlighting the pathogenic potential of these isolates [28].
Despite the potential for species of Candida to infect domestic animals and migratory birds and enter the environment in animal faeces, there is a lack of recognition of the one‐health potential of Candida persisting in agricultural systems. Therefore, the aim of this study was to determine whether fresh faeces of the migratory pink‐footed goose (Anser brachyrhynchus) were a source of drug‐resistant pathogenic species of Candida and the potential for these strains to subsequently persist in two different types of agricultural soil. We have quantified the resistance profiles of Candida isolated from goose faeces to four commonly used antifungal drugs, fluconazole, caspofungin, amphotericin B and voriconazole, and tested for pathogenicity in a Galleria mellonella model of infection. Finally, we have used multilocus sequence typing (MLST) to determine the genetic relatedness of Candida isolates from goose faces, with isolates of Candida recovered from sheep faeces collected in the same fields after the geese had left.
2. Methods
2.1. Field Sites and Faeces Collection
Two field sites in central Scotland (the United Kingdom) were identified as areas where large numbers of pink‐footed geese (A. brachyrhynchus) landed during migratory flights during September/October (Figure 1). At both sites, large flocks of geese (>500 birds) were observed resting in agricultural fields containing crop stubble following the recent harvest of the cereal crop.
Locations of two flocks of migratory pink‐footed geese. Geese faeces were collected at sites A (blue) and B (green) on a single day in October 2024. Specific locations of faeces collections are shown by black dots, with red dots indicating a location where a faecal pellet tested positive for Candida.
At 25 points across each site, four freshly deposited goose faecal pellets within a 3 × 3 m^2^ area (and the specific GPS location recorded) were collected as a composite sample and added to sterile 50 mL falcon tubes, giving a total of 100 faecal pellets at each of the two sites (Figure 1); there was no contact with any animals during any of the fieldwork. In addition, 20 soil samples and four stover samples were taken randomly at both sites. All faeces, soil and stover samples were processed on the day of collection.
A second visit to site A was carried out approximately 3 weeks after the first collection date, referred to herein as site AA. At this second visit, a flock of sheep had been moved into the field and were grazing on the stubble, but no geese were observed. Eight sheep faecal pellets were collected in individual sterile Falcon tubes and screened for Candida species on the day of collection. Additionally, any remaining goose faecal pellets were collected ad hoc to be used in subsequent mesocosm experiments (Section 2.4).
2.2. Isolation and Identification of Candida Species in Faeces
Replicate faecal samples (1 g) were homogenised in 10 mL phosphate‐buffered saline (PBS) by vortexing for 30 s in a sterile glass 30 mL universal vial. From this resuspension, 1 mL was added to 5 mL of yeast extract peptone dextrose (YPD) broth supplemented with antibiotics (gentamicin 50 mg/L, chloramphenicol 50 mg/L; Sigma‐Aldrich, USA) for pre‐enrichment. Replicate soil samples were processed in the same way; stover was added directly to 5 mL of YPD. All pre‐enrichment broths were incubated at 37°C for 48 h at 120 rpm in a shaking incubator (SciQuip, UK). Following incubation, serial dilutions were performed using PBS, and 10^0^, 10^−2^ and 10^−4^ dilutions were streaked onto CHROMagar Candida Plus agar (CHROMagar, France) and incubated at 37°C for 48 h. Positive colonies were putatively identified based on colony morphology and colour on CHROMagar. Stocks of each colony type were made by adding a single colony to a 1:1 (v:v) YPD and 80% glycerol solution and storing them at −80°C.
Single colonies from all Candida‐positive cultures were picked and added to 50 µL nuclease‐free water, and heat‐shocked at 95°C for 5 min to lyse the cells. PCR was performed using primers targeting the ITS region [29]. Briefly, 5 µL of the heat‐shocked solution was added to a PCR reaction made up as follows: 2x master mix (Qiagen, Germany), 0.4 µM forward and reverse primer (forward primer—5′ GTCAAACTTGGTCATTTA 3′ and reverse primer—5′ TTCTTTTCCTCCGCTTATTG 3′), and made up to 25 µL using molecular grade water. Cyclic conditions of 94°C for 30 s, 50°C for 30 s and 72°C for 2 min were run for 34 cycles, with an initial 3 min denaturation step at 94°C and a final extension step for 10 min at 72°C. Amplification was confirmed on a 1% agarose gel, and each PCR product was purified using a Promega Wizard PCR Purification Kit (Promega, UK). PCR products were Sanger sequenced using the ITS forward primer, and NCBI BLAST was used to confirm species ID (Table 1).
2.3. Antifungal Drug Resistance Assays
Minimum inhibitory concentration (MIC) analysis, following the European Committee on Antimicrobial Susceptibility Testing (EUCAST) antifungal MIC method for yeasts [30] (with slight modifications) [18], was conducted on all confirmed isolates of Candida. Each isolate was grown overnight at 37°C in 5 mL of YPD broth, and cells were recovered by centrifugation at 4000 × g for 4 minutes, washed, resuspended in 5 mL PBS, and concentrations adjusted to 10^5^ cells/mL. Four antifungal drugs were prepared in 10 two‐fold dilutions in Roswell Park Memorial Institute (RPMI) 1640 medium (Fisher Scientific, UK): amphotericin B (0.008–4 mg/L), caspofungin (0.008–4 mg/L), fluconazole (0.125–64 mg/L), voriconazole (0.008–4 mg/L) (Fisher Scientific, UK), and 100 µL of each drug concentration and 100 µL of each Candida isolate were added to each well of a 96‐well plate in triplicate. Control wells containing sterile drug‐free media, with 100 µL of each Candida isolate, were prepared and wells with no culture or drugs were also prepared. Plates were incubated at 37°C in a static incubator for 24 h. Growth was determined by measuring absorbance at 530 nm using a spectrophotometer (Infinite M200 plate reader; Tecan, Switzerland). The MIC of caspofungin, fluconazole and voriconazole was determined as the lowest concentration giving inhibition of 50% growth compared to a drug‐free control, whilst the MIC of amphotericin B was determined as inhibition of 90% growth.
2.4. Mesocosm Analysis of C. albicans Persistence in Soil
Three C. albicans isolates (CA05, CA10 and CA13) from goose faeces were selected to determine persistence in two common agricultural soil types with contrasting pH profiles (a loam and a podzol). Goose faecal pellets which tested negative for Candida on CHROMagar Candida Plus agar were used to create a faecal slurry: 6 g of goose faeces was mixed with 60 mL of PBS and thoroughly homogenised using a vortex for 60 s. The three selected C. albicans isolates originating from goose faeces were mixed with 60 mL of the faecal slurry to make a final volume of 120 mL, with final concentrations of 1.85 × 10^8^ (CA05), 1.8 × 10^8^ (CA10) and 1.85 × 10^8^ (CA13).
Replicate mesocosms were prepared by adding either 100 g of podzol or loam soil (pre‐screened to confirm the absence of any Candida species, dried at room temperature for 24 h and sieved to a uniform 4 mm) to sterile plastic pots (total volume 150 mL). To each mesocosm, 10 mL of one of the C. albicans faecal slurry inocula were added and thoroughly homogenised using a sterile spatula. A total of 52 mesocosms were set up, with five replicates for each of the three C. albicans isolates and one culture‐negative control for both soil types. All mesocosm pots were kept in a glasshouse with lids loosely attached, and the temperature was monitored using iButton temperature logger chips (iButtonLink, WI, 176 USA) (temperature range 9–16°C).
At each timepoint (1, 2, 3, 4, 7, 10, 14, 21, 28, 40 and 60 days) a sterile spatula was used to remove 5 g of soil from each replicate mesocosm, which was placed in a sterile 30 mL glass universal tube. Soil was mixed with 10 mL sterile PBS and vortexed for 30 s, serially diluted in PBS and plated out on SGA agar with gentamycin (10 mg/L), incubated overnight at 37°C and colony‐forming units (CFUs) enumerated. All colonies recovered from each mesocosm at each timepoint were phenotypically identical, and representative colonies were positively identified by PCR. At each time point 0.5 g of soil was also removed from each mesocosm to determine moisture content (105°C for 24 h) to calculate the concentration of Candida per soil dry weight.
2.5. Challenging G. mellonella With Candida Isolates
The pathogenicity of confirmed Candida isolates was tested in a G. mellonella (greater wax moth) larval infection model. Colonies from C. tropicalis (CT01) and three C. albicans isolates (obtained by sweeping the surface of plates) were resuspended in 150 µL of PBS, and six 10‐fold dilutions were made in PBS. G. mellonella larvae (Livefood, Axbridge, UK) were set up in groups of 10, and each individual larva was injected in the haemocoel via the last right pro‐limb with 10 µL of the Candida isolate using a sterile Hamilton syringe and a 0.45 mm gauge needle and kept at 37°C for 10 days. In addition, three groups (n = 10) of larvae were injected with sterile PBS as negative injection controls. Larvae were considered dead when they did not respond to touch.
2.6. MLST of C. albicans Isolated From Geese and Sheep Faeces
MLST analysis, based on the amplification and sequence alignment of seven housekeeping genes, AAT1a, ACC1, ADP1, MPIb, SYA1, VPS13 and ZWF1 [31, 32], was used to determine the relatedness of C. albicans isolated from geese and sheep faeces. Seven independent PCRs were performed for each gene for each isolate using previously published primers [31] using the following reaction set up; a 2x master mix (Qiagen, Germany), 0.4 µM forward and reverse primer and 5 µL of the heat‐shocked colony solution, made up to 25 µL with nuclease‐free water (Ambion, UK). PCR cyclical conditions were 94°C for 30 s, 50°C for 30 s and 72°C for 1 min, and run for 34 cycles, with an initial 3 min at 94°C and final extension of 72°C for 10 min. The resulting products were visualised using 1% agarose gel electrophoresis and purified using a Wizard SV Gel and PCR Clean Up Kit (Promega, UK). Quantified fragments were Sanger sequenced, and the resulting FASTA files were trimmed, aligned and concatenated in MEGA X [33]. The concatenated sequences were aligned using MUSCLE with 300 C. albicans reference sequences, taken from the C. albicans MLST database. The 300 C. albicans reference sequences were selected at random from the list of 4486 sequences and were used to determine the relatedness of the C. albicans isolated from geese and sheep faeces in this study, rather than how these isolates fit into the wider context of global C. albicans sequences. Using MEGA X, a maximum‐likelihood phylogenetic tree was constructed using 500‐bootstrap iterations, and the final image was generated using iTOL [34].
2.7. Statistical Analyses
C. albicans die‐off rates in soil were calculated by first transforming concentrations to log_10_ CFU/g. Linear regression analysis was then used to determine the dynamics of C. albicans die‐off (Minitab v18; Minitab Inc.; State College, PA, USA). Briefly, a log‐linear regression model was fitted to the log_10_‐transformed data, which is described by the equation:
where C0 is the cell concentration at t = 0 and k is the die‐off rate constant (day minus one).
The percentage decrease in C. albicans concentration per unit time was determined as constant using the log‐linear model. Following a log‐linear die‐off profile, decimal reduction times (D‐values; the number of days to reduce viable yeast by 90%) were calculated based on the decline rates for each population.
Statistical analyses of the Kaplan–Meier survival curves were calculated in Graphpad Prism (v10). A Mantal‐Cox log‐rank statistical analysis for the Kaplan–Meier survival curves for each 10‐fold dilution was performed with values determined by comparing the differences in survival between each of the three C. albicans isolates examined.
3. Results
3.1. Recovery of C. albicans From Goose Faeces at Two Field Sites
During the first round of field sampling, C. albicans was detected in seven goose faecal pellets at site A (7/100) and three faecal pellets at site B (3/100), which were confirmed by Sanger sequencing of the ITS region (Table 1). Additionally, C. tropicalis was detected in one soil sample from site A, Candida guilliermondii was detected in a single goose faecal pellet at site B and some additional faecal pellets gave false positives on CHROMagar Candida Plus agar for other Candida species (Table 1). On the second visit to site A (visit AA), 9/25 goose faecal pellets were positive for Candida, with four isolates positively confirmed as C. albicans and three confirmed as P. kudriavzevii (formerly C. krusei). Four of the eight sheep faecal pellets tested positive for C. albicans (Table 1, Figure S1).
3.2. Screening Candida Isolates for Antifungal Resistance
All Candida isolates exhibited some resistance to at least one of the four classes of antifungal drugs they were screened against (Figure 2). C. tropicalis isolated from soil showed some tolerance to voriconazole (0.0625 mg/L) and resistance to amphotericin B (4 mg/L) and fluconazole (8 mg/L). Most of the C. albicans isolates from the goose and sheep faeces (with the exception of one isolate) showed resistance to amphotericin B (>1 mg/L), and some level of tolerance to fluconazole (2 mg/L), although they were all susceptible to voriconazole (<0.06 mg/L). No EUCAST breakpoints are available for caspofungin, but C. albicans isolated from sheep faeces were more susceptible to caspofungin than isolates from geese faeces.
Figure 2. Minimum inhibitory concentration (MIC) of all confirmed Candida isolates from goose and sheep faeces, and soil. (A) Amphotericin B (0.008–4 mg/L), (B) caspofungin (0.008–4 mg/L), (C) fluconazole (0.125–32 mg/L) and (D) voriconazole (0.008–4 mg/L). There were three replicates per isolate, error bars indicate the SEM.(A)(B)(C)(D)
3.3. Persistence of C. albicans in Agricultural Soil
The three C. albicans isolates (CA05, CA10 and CA13) were able to persist in both loam and podzol soils for a minimum of 60 days (Figure 3). By day 60, in both soil types, concentrations of C. albicans had only decreased by ~1 log CFU/g, with all isolates remaining viable as determined by their recovery on selective media. Log‐linear regression models were used to determine the linear decline rate constants (K) and decimal reduction times (D‐values) of the three C. albicans isolates in both soil types (Table S1). Although all three isolates remained detectable at high concentrations for the duration of the study, the D‐values varied, with C. albicans isolate CA10 having the lowest D‐value in podzol (52.8). All isolates recovered from the podzol had higher D‐values than the isolates recovered from the loam.
Figure 3. Persistence of C. albicans CA05 (red squares), CA10 (green triangles) and CA13 (black inverse triangles) isolates from goose faeces in (A) loam soil and (B) podzol. Data points represent the mean (n7= 5) ± SEM.(A)(B)
3.4. Pathogenicity of Candida Isolates
All three C. albicans isolates were pathogenic in the G. mellonella infection model, with the undiluted inoculum causing >95% probability of death within 24 h (Figure 4). Larvae injected with the 10^−1^ dilutions had a 5%–20% probability of survival by day 10, with no statistically significant difference between the three isolates; however, survival of larvae injected with the 10^−2^ dilution did significantly differ (p < 0.05) with G. mellonella injected with isolates CA10 and CA13 having a higher probability of survival. At lower concentrations (10^−4^ and 10^−5^) there were no significant differences in pathogenicity between the three C. albicans isolates, with a probability of larval survival >60% (Figure 4, Table S2). However, injection of larvae with C. albicans at the lowest concentrations still had a lower survival probability than being injected with just PBS, which had a 100% survival rate after 10 days.
Kaplan–Meier survival curves for a Galleria mellonella infection model challenged with three C. albicans isolates. Initial undiluted (100) concentrations were 6.17 × 106/injection for CA05, 1.07 × 107/injection for CA10 and 8.50 × 106/injection for CA13, and a series of 10‐fold dilutions down to 10−5 were used as inoculum. Survival was recorded over 10 days. Each line represents the survival proportion of 30 G. mellonella injected with a 10‐fold dilution for each concentration.
3.5. Phylogenetic Analysis of C. albicans Isolates From Goose and Sheep Faeces Using MLST
Maximum likelihood phylogenetic analysis of the MLST sequences revealed that C. albicans isolates from both field sites and from goose and sheep faeces were relatively conserved; however, isolates from the sheep and geese clustered independently from one another on separate clades (Figure 5). The three C. albicans isolates from sheep all differed from one another but still clustered closely on the same clade, whilst the isolates from the goose faeces formed two closely related clades (CA01, CA07 and CA09 in one, and CA08, CA11 and CA12 in the other). The closest reference sequences on the same clade are isolates from the USA, Germany and South Korea (DST1085, 414 and 1597, respectively). The two closest sequences, DST1597 from South Korea and DST1085 from the USA, share the same allelic matches for VPS13 and MP1b and AAT1 as some of the isolates in this study (CA07, CA12 and CA18).
Maximum likelihood phylogenetic analysis of seven C. albicans isolates from goose and sheep faeces and 300 known C. albicans isolates. C. albicans isolates from geese and sheep faeces are highlighted in blue and green respectively. Sequences were aligned using MUSCLE and the phylogenetic tree was generated using 500‐bootstrap iterations in MEGA X. Isolates CA05, CA10 and CA13 were excluded from analysis as good quality VPS13 sequences were not obtained.
The allelic profile of each isolate was compared for each of the seven genes using the C. albicans MLST database (Table S3). Comparing the allelic matches for the individual genes indicated some similarities between isolates from geese (CA12) and sheep (CA18) and between two isolates from sheep (CA16 and CA17); however, none of the sequences had exactly the same allelic matches for all seven genes (Table S3).
4. Discussion
Viable isolates of C. albicans were isolated from the faeces of migratory pink‐footed geese and domestic sheep; however, our data were unable to resolve whether C. albicans was being introduced into agricultural environments by the migrating birds or whether sheep are a long‐term host and geese are being exposed to C. albicans by sharing fields with grazing sheep and their faeces. Alternatively, both geese and sheep may ingest C. albicans after being exposed to agricultural soil that has been contaminated via surface water irrigation or flooding, or from the faeces of other species frequenting the sites [20]. However, despite the origin of infection remaining unknown, it is clear that the faeces from migratory geese can act as a potential source of C. albicans, and due to the transient habit of these birds, this opportunistic pathogen could be dispersed over a wide geographical range of agricultural and food production environments.
It has been estimated that ~300,000 pink‐footed geese migrate from Iceland to Scotland in the autumn [35], although there are also significant populations migrating from Greenland and Svalbard, which together with small numbers of several other migratory geese species, for example light‐bellied brent goose and Svalbard barnacle goose, produce a large volume of faecal material deposited into the environment every day. At the second sampling time point, some of the goose faeces remained in the field and continued to test positive for C. albicans. These goose faecal pellets were visibly older, partially desiccated and beginning to break down into the soil, indicating that C. albicans can persist outside the host for an extended period of time. Despite C. albicans being present in multiple faecal pellets at each site visit, it was not recovered from the soil or stover that was in close proximity to the faecal pellets. This suggests that transitory loading of faeces from these migratory birds was the de novo input of C. albicans into this environment, and cells had not yet dispersed into the soil from this primary source (e.g., by rain splash).
C. albicans has previously been isolated from the oesophagus of geese and ducks [27], and multidrug‐resistant C. albicans has been associated with disease in several species of tropical birds. Although Candida is not generally considered to be zoonotic, geese may be acting as a reservoir for multiple species of Candida. The majority of Candida isolates recovered from the faeces of pink‐footed geese were C. albicans, but several other species of opportunistic yeast were also isolated, including P. kudriavzevii (formerly C. krusei) and Meyerozyma guilliermondii (C. guilliermondii).
In the environment, P. kudriavzevii is often isolated from soils (although not in this study), with some indications that it may even be beneficial for soil health [36]. However, P. kudriavzevii is also becoming of increasing concern as an emerging nosocomial pathogen and was added to the WHO Fungal Pathogen Priority List [8] due to its natural resistance to fluconazole and potential to cause opportunistic invasive infections [37]. In this study, a single positive isolate of multidrug‐resistant C. tropicalis was also recovered from the soil. This species is also on the WHO Fungal Pathogen Priority List and is also commonly isolated from the environment, including in soil [10, 17]. Other isolates from the soil and stover putatively identified as Candida were later confirmed as Arthrographis kalrae by Sanger sequencing. A. kalrae is commonly associated with soils but can cause fungal keratitis, and very rarely more severe infections [38, 39].
Three C. albicans isolates recovered from goose faecal pellets were used to simulate the delivery of C. albicans in goose faeces into agricultural soils. All three isolates persisted at fairly high concentrations for at least 60 days, indicating that once shed from a host, C. albicans can persist and remain culturable in the environment. Importantly, C. albicans was equally able to tolerate the edaphic conditions of both the loam and the more acidic podzol, with no difference in the decay rate over 60 days. C. albicans can dimorphically switch between yeast and hyphal forms, which is usually triggered by a change in environmental and nutritional cues and is characterised by an increased adaptability and pathogenicity [40]. Therefore, when C. albicans leaves a host in its faeces and subsequently enters the soil environment, with stressors such as changes in temperature and pH, it may switch from one morphological form to the other in a way that is beneficial for its long‐term environmental survival.
All sequenced isolates of C. albicans from goose faeces clustered together using an MLST analysis approach, and although all three of the sequenced isolates from sheep faeces clustered independently from the goose isolates, they were positioned on a neighbouring clade of the maximum likelihood phylogenetic tree. When compared to ~300 reference C. albicans sequences, all the isolates from this study clustered closely together, indicating a higher degree of relatedness between the isolates recovered from both the geese and sheep faeces. Furthermore, analysis of individual genes indicated several allelic matches between the different isolates, with one goose and one sheep isolate sharing four out of seven allelic matches. Although the sequences clustered by either goose or sheep host, they were closely aligned to each other. It has previously been shown that C. albicans sequences do not cluster into species‐specific lineages [41], despite some degrees of separation, as observed here. The close relatedness between the different isolates from this study and the isolates from the USA, Germany and South Korea potentially provides evidence that animals could be reservoirs of C. albicans isolates that can also cause human infection [42], in a similar way to the transmission patterns of C. glabrata between gulls and humans [43].
Although no C. albicans were detected in the limited soil samples collected at either site in this study, potentially pathogenic C. albicans isolates can persist in soil, which allows them to come into contact with a range of mammalian and avian hosts in a shared environmental space [21]. Agricultural soils are also likely exposed to fungicides, for example, through the spraying of crops, seed coating applications, or through irrigation with potentially contaminated surface waters (e.g., rivers) containing fungicide residues [44]. Constant exposure to trace amounts of fungicides in the soil could induce adaptive changes in C. albicans introduced into the soil via faeces, potentially resulting in enhanced resistance or increased virulence of the fungal pathogen [6]. This could be further exacerbated by environmental stresses such as pH changes and extremes of temperature, as C. albicans responds differently to antifungal exposure when under stress in acidic environments [45, 46], such as the podzol soil.
5. Conclusion
The unrestricted movement of migratory birds provides significant opportunity for the widespread dissemination of pathogens [47]. The cross‐boundary nature of animal migration increases the geographical transmission of emerging pathogens, or novel variants of common pathogens (e.g., with enhanced drug resistance or virulence), by facilitating exposure to new hosts or environments. Here we have demonstrated the presence of viable isolates of C. albicans in the faeces of migratory geese deposited in agricultural fields, which were subsequently able to survive in agricultural soils for an extended period. Environmental persistence of C. albicans has the potential to facilitate transmission between animal species or humans despite them never actually coming into direct contact with each other. Such zoonotic potential of an opportunistic pathogen such as C. albicans in agricultural systems could be further intensified by repeated exposure to low levels of fungicides and the potential to develop resistance to antifungals.
Author Contributions
Luke Woodford: conceptualisation, investigation, methodology, data curation, formal analysis, writing – original draft preparation. Craig J. Engelbrecht: investigation, writing – reviewing and editing. Maiken Skov: investigation, writing – reviewing and editing. Richard S. Quilliam: conceptualisation, writing – reviewing and editing, supervision.
Funding
This work was supported by the University of Stirling.
Disclosure
The funder had no role in study design, data collection and analysis, the decision to publish, or the preparation of the manuscript.
Ethics Statement
Ethical approval for this project was authorised by the General University Ethics Panel (Ref. GUEP 6748) from the University of Stirling.
Conflicts of Interest
The authors declare no conflicts of interest.
Supporting Information
Additional supporting information can be found online in the Supporting Information section.
Supporting information
Supporting Information Table S1: Linear decline analysis of persistence of Candida albicans isolates in loam and podzol soils. Table S2: Log‐rank statistical analysis for the Kaplan‐Meier survival curves for each 10‐fold dilution. Table S3: Allelic matches for 12 C. albicans isolates using seven housekeeping genes. Figure S1: All fungi identified by ITS Sanger sequencing from CHROMagar Candida Plus agar colony isolation.
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1Gnat S. , Łagowski D. , Nowakiewicz A. , and Dyląg M. , A Global View on Fungal Infections in Humans and Animals: Opportunistic Infections and Microsporidioses, Journal of Applied Microbiology. (2021) 131, no. 5, 2095–2113, 10.1111/jam.15032.33556223 · doi ↗ · pubmed ↗
- 2Seyedmousavi S. , Bosco S. D. M. , and De Hoog S. , et al.Fungal Infections in Animals: A Patchwork of Different Situations, Medical Mycology. (2018) 56, no. suppl_1, S 165–S 187, 10.1093/mmy/myx 104, 2-s 2.0-85044741748.PMC 625157729538732 · doi ↗ · pubmed ↗
- 3Bongomin F. , Gago S. , Oladele R. O. , and Denning D. W. , Global and Multi-National Prevalence of Fungal Diseases—Estimate Precision, Journal of Fungi. (2017) 3, no. 4, 10.3390/jof 3040057, 2-s 2.0-85041834703, 57.29371573 PMC 5753159 · doi ↗ · pubmed ↗
- 4Lass-Flörl C. , Kanj S. S. , Govender N. P. , Thompson G. R.III, Ostrosky- Zeichner L. , and Govrins M. A. , Invasive Candidiasis, Nature Reviews Disease Primers. (2024) 10, no. 1, 10.1038/s 41572-024-00503-3, 20.38514673 · doi ↗ · pubmed ↗
- 5Siscar-Lewin S. , Hube B. , and Brunke S. , Emergence and Evolution of Virulence in Human Pathogenic Fungi, Trends in Microbiology. (2022) 30, no. 7, 693–704, 10.1016/j.tim.2021.12.013.35058122 · doi ↗ · pubmed ↗
- 6Bastos R. W. , Rossato L. , Goldman G. H. , and Santos D. A. , Fungicide Effects on Human Fungal Pathogens: Cross-Resistance to Medical Drugs and Beyond, PLOS Pathogens. (2021) 17, no. 12, 10.1371/journal.ppat.1010073, e 1010073.34882756 PMC 8659312 · doi ↗ · pubmed ↗
- 7Fisher M. C. , Alastruey-Izquierdo A. , and Berman J. , et al.Tackling the Emerging Threat of Antifungal Resistance to Human Health, Nature Reviews Microbiology. (2022) 20, no. 9, 557–571, 10.1038/s 41579-022-00720-1.35352028 PMC 8962932 · doi ↗ · pubmed ↗
- 8World Health Organization , WHO Fungal Priority Pathogens List to Guide Research, Development and Public Health Action, 2022, WHO, https://www.who.int/publications/i/item/9789240060241.