Pathogenicity, immunogenicity, and cross-protective efficacy of representative Eimeria brunetti strains in Chinese yellow-feathered broilers: an in vivo evaluation
Jia-Hui Kang, Jia-Jia Tan, Rui-Zhen Wang, Xiao-Ling Deng, Zi-Ying He, Xiao Lu, Li-Dang Liu, Ya-Biao Weng, Rui-Qing Lin

TL;DR
This study evaluates how different strains of Eimeria brunetti affect Chinese yellow-feathered broilers and shows that an attenuated strain could serve as an effective vaccine.
Contribution
The study demonstrates cross-protection among geographic Eimeria brunetti strains and identifies a promising attenuated strain for vaccine development.
Findings
The Baoding 2 strain had the highest reproductive capacity, while the Zhangzhou strain caused the most severe intestinal lesions.
Immunization with field strains improved weight gain, reduced lesions, and lowered oocyst output upon challenge.
An attenuated precocious strain reduced oocyst shedding by 93.61–99.92%, showing strong protective potential.
Abstract
Biological characterization of geographic strains of Eimeria brunetti was conducted to inform control strategies. The prepatent period was consistent (118–122 h) across strains, though the Baoding 2 strain exhibited the highest reproductive capacity while the Zhangzhou strain induced the most severe intestinal lesions. Infection significantly impaired weight gain and intestinal integrity, with optimal oocyst sporulation occurring at 25% litter moisture. Immunization with field strains elevated IgY levels and modulated cytokine responses. Upon challenge, immunized birds demonstrated improved weight gain, reduced lesions, and markedly lower oocyst output. Notably, an attenuated precocious strain conferred strong protection, reducing oocyst shedding by 93.61–99.92%. These findings demonstrate the significant pathogenicity of E. brunetti in Chinese yellow-feathered broilers and establish…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsCoccidia and coccidiosis research · Bird parasitology and diseases · Animal Nutrition and Physiology
Introduction
Avian coccidiosis, caused by protozoan parasites of the genus Eimeria, is a globally significant enteric disease in chickens, resulting in substantial economic losses estimated at approximately £10.4 billion annually to the poultry industry (Blake et al., 2020). These losses are of particular concern in China, a leading global producer and consumer of broiler chickens. Among the seven recognized species of chicken Eimeria, Eimeria brunetti is a highly pathogenic species known to infect the lower small intestine and rectum, often causing severe hemorrhagic enteritis, mucosal necrosis, and impaired nutrient absorption (Chapman, 2014). Clinical manifestations include reduced weight gain, diarrhea, increased water consumption, and in severe cases, mortality, with peak severity occurring 5–7 days post-infection (Kawahara et al., 2014).
Earlier surveys reported a low prevalence of E. brunetti in broiler flocks in China (Geng et al., 2021). However, our recent nationwide epidemiological survey, encompassing 841 fecal samples from yellow-feathered broilers across 16 provinces, has challenged this view, revealing a high overall infection rate of 34.20% (Kang et al., 2024). This newly recognized high prevalence highlights a critical gap in protection. Current control in yellow-feathered broiler production faces dual challenges. Prophylaxis still relies heavily on anticoccidial drugs, yet drug resistance is a growing concern (Peek and Landman, 2011). For immunization, the industry predominantly uses live vaccines targeting E. tenella, E. acervulina, E. maxima, and E. necatrix, which offer no cross-protection against E. brunetti (Chapman, 2014). Furthermore, the widespread use of such vaccines may shift species dominance, potentially creating an ecological niche for pathogenic species such as E. brunetti (Liao et al., 2024). While imported live vaccines containing E. brunetti are available, most are based on virulent strains, raising safety concerns. Domestically produced vaccines in China seldom include E. brunetti, leaving flocks vulnerable.
Despite its emerging threat status and the clear protection gap, comprehensive data on the basic biological characteristics, pathogenicity, immunogenicity, and cross-protective potential of prevalent Chinese strains of E. brunetti remain limited. This lack of knowledge impedes the development of effective, tailored control strategies. Therefore, this study aimed to: (1) isolate and biologically characterize representative geographic strains of E. brunetti from China; (2) evaluate their pathogenicity and impact on gut health; (3) assess their immunogenicity and cross-protective efficacy against heterologous strains; and (4) evaluate the protective potential of an attenuated precocious line as a vaccine candidate. Addressing these objectives provides crucial foundational knowledge on the biology and immunology of E. brunetti, which is essential for informing the future development of specific control strategies for the Chinese poultry industry.
Materials and methods
Ethics statement
All animal care and use protocols were approved by the Animal Experimentation and Ethics Committee of Foshan Standard Bio-Tech Co., Ltd. The study was conducted in strict accordance with the committee’s standard operating procedures based on the Chinese legislation on animal welfare and the Guide for the Care and Use of Laboratory Animals.
Parasite Strains
The E. brunetti strains utilized in this study comprised a precocious line and multiple field isolates (EB-BD1 and EB-BD2 from Hebei Province; EB-ZZ from Fujian Province) to encompass a degree of regional diversity. All field strains were isolated from poultry farms with no history of using E. brunetti-containing vaccines. The precocious line was generously provided by Foshan Standard Bio-Tech Co., Ltd. This line had been attenuated through 18 successive generations of selection for early patency, resulting in a reduced prepatent period from 128 h to 90 h.
Experiment 1: Isolation, Molecular Identification, and Basic Biological Characterization
Single-oocysts isolation and propagation
E. brunetti oocysts from field samples were isolated and propagated. Briefly, samples were homogenized in distilled water and sequentially filtered through standard laboratory sieves with mesh sizes of 100, 200, and 300, corresponding to nominal pore sizes of approximately 150 µm, 75 µm, and 50 µm, respectively, to remove coarse and fine debris. The filtrate was centrifuged at 1,800 × g for 1 min (repeated multiple times until the supernatant was clear, with a final centrifugation at 2,300 × g). Oocysts were purified by flotation in saturated saline (centrifugation at 2,800 × g for 2 min). The oocyst-containing supernatant was diluted with water and centrifuged again (2,800 × g for 3 min) to collect the purified oocysts. Oocysts were sporulated in 1% chloramine-T (Tan and Weng, 2008) with shaking (130 rpm) at 28°C for 40 h and stored at 4°C.
For single-oocyst isolation, the concentration of the sporulated suspension was determined using a hemocytometer, and it was diluted with distilled water to ∼1,000 oocysts/mL. Using a light microscope (CX23; Olympus, Japan), 1 µL droplets containing a single E. brunetti oocyst (confirmed morphologically at 400 ×) were identified. Each identified single oocyst, adsorbed onto a small piece of sterile tissue paper, was gently placed into the esophagus of a 3-day-old SPF chick using forceps. To ensure ingestion, a small volume of coccidia-free water was then administered via a 1 mL syringe to help the chick swallow the tissue paper.
Fecal samples were collected daily from day 4 post-inoculation. Oocyst shedding was detected by saline flotation. Samples from days 5-7 were collected from positive chickens, and the derived oocysts were purified, sporulated, and stored at 4°C in 1% chloramine-T for subsequent use.
Molecular identification and phylogenetic analysis
DNA extraction and species confirmation
Genomic DNA was extracted from oocysts of each strain using the Wizard® SV Genomic DNA Purification System (Guangzhou Xiandu, China) following mechanical disruption with a TissueLyser II (Qiagen, Germany). The presence and purity of E. brunetti DNA were confirmed by a TaqMan probe-based qPCR assay targeting the SCAR marker (Vrba et al., 2010) . Each qPCR run included negative (no-template) and positive (known E. brunetti DNA) controls.
ITS-1 gene amplification and sequencing
For phylogenetic analysis, standard PCR was performed to amplify the ITS-1 region using previously established primers (F:AAGTTGCGTAAATAGAGCCCTC, R:AGACATCCATTGCTGAAAG) (Kumar et al., 2015) . The 25 µL PCR reactions contained 12.5 µL of 2X PCR Master Mix (Takara, Japan), 1 µM of each primer, and 1 µL of template DNA. Amplified products of the expected size were gel-purified using the GeneJET Gel Extraction Kit (Thermo Fisher Scientific, USA), cloned into the pMD18-T vector (Takara, Japan), and transformed into E. coli DH5α competent cells. Positive clones, identified by colony PCR, were sequenced by BGI Genomics (China).
Phylogenetic analysis
The obtained sequences were aligned and compared with reference sequences from GenBank using BLAST. Multiple sequence alignment was performed with ClustalW in MEGA 11.0 (Tamura et al., 2021). A Neighbor-Joining phylogenetic tree was constructed based on the ITS-1 region, with bootstrap support calculated from 1000 replicates (Saitou and Nei, 1987).
Morphological analysis of oocysts
Sporulated oocysts of each geographical strain, obtained via single-oocyst inoculation, were examined under an inverted fluorescence microscope (Nikon Eclipse Ti2, Japan) at 400 × magnification. For each strain, images of 100 oocysts were captured, and their length and width were measured using the NIS-Elements software (Nikon, Japan, Version 5.11). The morphological features were compared to established descriptions of E. brunetti to confirm species identity.
Assessment of prepatent period, fecundity, and oocyst shedding dynamics
In this and subsequent experiments, the day of hatching was considered day 1 of age. A total of 100 three-day-old Yellow chickens (This age was chosen to ensure a naive immunologic status for primary infection) with similar body weights (birds were selected for uniform size) were randomly allocated into 10 groups (Groups 1-10, n = 10 each) in a 3 × 3 factorial design plus one control group, as detailed in Table 1, to assess the effects of geographical strain and inoculation dose. Birds were maintained in battery cages within a coccidia-free environment and fed a coccidia-free diet. Groups were orally inoculated according to the factorial design in Table 1 with one of the corresponding strain and dose of sporulated oocysts, while the control group received phosphate-buffered saline.Table 1. Experimental design for assessing the prepatent period, fecundity, and oocyst shedding dynamics of geographical Eimeria brunetti strains.Table 1 dummy alt textGroupStrainInoculation Dose(sporulated oocysts per bird)Group Code1EB-ZZ500EB-ZZ-12EB-ZZ1,000EB-ZZ-23EB-ZZ2,000EB-ZZ-34EB-BD1500EB-BD1-15EB-BD11,000EB-BD1-26EB-BD12,000EB-BD1-37EB-BD2500EB-BD2-18EB-BD21,000EB-BD2-29EB-BD22,000EB-BD2-310ControlPBS—Note: All inoculated groups (Groups 1–9, n = 10 per group) received a single oral dose of sporulated oocysts. The control group (Group 10, n = 10) received an equivalent volume of phosphate-buffered saline (PBS).
Fecal collection began at 110 h post-inoculation (hpi). Samples were collected hourly to determine the prepatent period, defined as the time when oocysts were first detected via saturated sodium chloride flotation. Thereafter, feces were collected every 24 h, weighed, and the number of oocysts per gram (OPG) was quantified in duplicate using a McMaster counting chamber. Total and per-bird oocyst output were calculated, and shedding patterns were visualized using GraphPad Prism (Version 9.0).
Determination of optimal litter moisture for sporulation
To determine the optimal moisture for sporulation, fifteen-day-old coccidia-free Yellow chickens were inoculated with 10,000 sporulated oocysts of E. brunetti per bird. Feces collected during peak shedding (days 5-7 post-inoculation) were processed for oocyst purification.
Purified oocysts were mixed with rice hull litter adjusted to moisture levels of 10%, 15%, 20%, 25%, 35%, 45%, and 55% (w/w) by adding sterile distilled water, and verified with a Delmhorst moisture meter. The mixtures were prepared at a concentration of 1 × 10⁴ oocysts per gram of litter (dry weight equivalent). For each moisture level, 30 g of the mixture was placed in a sealed plastic container (10 cm diameter × 11.5 cm height). Four replicate containers were prepared per moisture level. Containers were incubated at 28°C, and ventilation by opening the lid for 30 seconds every 12 h. A control group was sporulated in 1% chloramine-T solution with shaking (150 rpm) at 28°C.
Sporulation was assessed every 12 h from 24 to 96 h post-incubation. For each time point, two 1 g samples were randomly collected from each container (n = 2 subsamples per container), and 100 oocysts per sample were examined to calculate the sporulation rate. Litter moisture was monitored and adjusted every 24 h by adding sterile distilled water as needed to maintain target levels throughout the experiment.
Experiment 2: Assessment of pathogenicity and impact on gut microbiota
Experimental design, bird management, and inoculation
A total of 100 one-day-old Yellow chickens were reared in wire-floor battery cages within a strictly coccidia-free environment. Birds were fed a nutritionally complete, unmedicated diet (free of anticoccidial drugs) ad libitum. At 18 days of age (d18), birds were individually weighed and randomly assigned to ten groups (n = 10) in a 3 × 3 factorial design plus one control group, using higher inoculation doses (2.5 × 10⁴, 5.0 × 10⁴, and 1.0 × 10⁵ oocysts per bird). The control group received 1 mL of PBS. All inoculations were administered orally using a 1 mL syringe without a needle.
Clinical monitoring, lesion scoring, and histopathology
Chickens were monitored daily for clinical signs and mortality. Body weights were measured on d18 (day 0 post-inoculation, 0 dpi) and d24 (6 dpi). The weight gain and relative weight gain were then calculated and statistically analyzed using Tukey‘s multiple comparison test in GraphPad Prism (v9.0). All surviving birds were euthanized at 6 dpi (d24) for necropsy. Intestinal lesions, particularly in the rectal region, were scored according to a modified Johnson and Reid scoring system (Johnson and Reid, 1970), where the modification consisted of placing greater emphasis on hemorrhagic and necrotic changes in the rectum and lower ileum, consistent with E. brunetti pathogenesis. Mean lesion scores were calculated for each group.
For histopathology, tissue samples from various intestinal segments were collected and fixed in 10% neutral-buffered formalin. Following standard processing and paraffin embedding, 4 µm sections were prepared, stained with hematoxylin and eosin (H&E), and examined under a light microscope (Nikon Eclipse E200, Japan) for pathological changes.
Gut microbiota analysis
Intestinal contents from the distal small intestine were aseptically collected from three birds randomly selected from groups inoculated with the Zhangzhou strain (Groups 1–3) and three birds from the negative control (Group 10), and stored at –80°C. Microbial DNA was extracted using the CTAB method, with quality verified by electrophoresis and spectrophotometry (NanoDrop). The V3–V4 hypervariable region of the bacterial 16S rRNA gene was amplified with primers 341F and 806R using Phusion Hot Start Flex Master Mix. The PCR products were purified, quantified, and sequenced on an Illumina NovaSeq 6000 platform (2 × 250 bp). Bioinformatic analysis was performed in QIIME2 (v2021.4). Raw paired-end reads were demultiplexed, quality-filtered, and denoised to generate amplicon sequence variants (ASVs) using the DADA2 plugin. The resulting ASV table was used to calculate alpha diversity indices (Observed ASVs, Chao1, Shannon, Simpson) and beta diversity metrics (Bray-Curtis dissimilarity) for subsequent statistical comparisons.
Experiment 3: Evaluation of cross-protective efficacy of geographical strains
Immunization-challenge experimental designs
To evaluate the homologous and heterologous protective immunity, a total of 160 three-day-old Yellow chickens were randomly allocated into eight groups (n = 20) for each of the three geographical strains (EB-ZZ, EB-BD1, EB-BD2) following an identical scheme. The design for the EB-ZZ strain is detailed in Table 2 as an example. Chickens in immunization groups were inoculated with the respective strain at 3, 10, and 17 days of age (d3, d10, d17). At d24, designated groups were challenged with homologous or heterologous strains, while controls included unimmunized-challenged and unimmunized-unchallenged groups. This design employed a serial sacrifice/sampling scheme; subsets of birds from each group were euthanized at specified time points for sample collection (blood, tissue, intestinal content), while growth performance and clinical signs were monitored on all live birds throughout the study period.Table 2. Experimental design for evaluating homologous and heterologous protection elicited by EB-ZZ strain immunization.Table 2 dummy alt textGroupTreatmentImmunization Schedule (Oocysts per Bird)Challenge (24 days)3 days10 days17 daysStrain (5 × 10⁴)1Immunized + EB-ZZ ChallengeEB-ZZ (500)EB-ZZ (2,000)EB-ZZ (2,000)EB-ZZ2Immunized + EB-BD1 ChallengeEB-ZZ (500)EB-ZZ (2,000)EB-ZZ (2,000)EB-BD13Immunized + EB-BD2 ChallengeEB-ZZ (500)EB-ZZ (2,000)EB-ZZ (2,000)EB-BD24EB-ZZ Challenge Only———EB-ZZ5EB-BD1 Challenge Only———EB-BD16EB-BD2 Challenge Only———EB-BD27Immunization Only (Control)EB-ZZ (500)EB-ZZ (2,000)EB-ZZ (2,000)—8Blank Control————Note: All groups consisted of 20 birds at the start of the experiment. The immunization and challenge were administered orally.
Growth performance, oocyst output, and mortality
Individual body weights were recorded on days 3, 10, 17, 24, and 30. Average body weight gain and relative gain were calculated for immunization (days 3-24) and post-challenge (days 24-30) phases. Clinical signs and mortality were monitored daily, and necropsy was performed on dead birds to ascertain cause of death.
Fecal samples were collected at 24-hour intervals between 120 and 192 h post-immunization and post-challenge. Oocysts per gram (OPG) of feces were quantified in duplicate using the McMaster method. Group mean OPG and oocyst reduction rates post-challenge (vs. non-immunized challenged controls) were calculated.
Serum IgY antibody response (ELISA)
Serum was collected from six birds per group on days 3, 10, 17, 24, and 30 (pre-immunization and 7 days post-each immunization), and 6 days post-challenge. IgY levels were measured by an indirect ELISA. Briefly, 96-well plates were coated overnight at 4°C with sporulated oocyst crude antigen of the EB-ZZ strain at 2 µg/mL in coating buffer for 2 h at 37°C. After washing, plates were blocked with 5% skim milk at 4°C overnight. Serum samples at a dilution of 1:50 were added and incubated for 1 h at 37°C, followed by goat anti-chicken IgY conjugated to horseradish peroxidase (Sigma-Aldrich) at a dilution of 1:4,000 30 min at 37°C. The reaction was developed with tetramethylbenzidine (TMB) substrate for 15 min at 37°C, stopped with stop solution, and the absorbance was measured at 450 nm with a reference wavelength of 620 nm. All samples were tested in duplicate, and antibody levels are expressed as the optical density value at 450 nm (OD450).
Cytokine gene expression analysis (qPCR)
Rectal tissues were sampled from five immunized unchallenged birds per time point (days 10, 17, 24). Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Germany), reverse transcribed using the HiScript III Kit (Vazyme, China), and analyzed by SYBR Green qPCR for cytokine mRNA levels (IFN-γ, IL-2, IL-10, IL-17A, IL-4, IL-12, IL-6, TGF-β) using gene-specific primers (Hong et al., 2006; Xu et al., 2015; Li et al., 2018; Yu et al., 2021) . The primer sequences are listed in Table 3. The qPCR reaction was performed in a 20 µL system containing: 10 µL of 2 × ChamQ Universal SYBR qPCR Master Mix (Vazyme, China), 0.4 µM of each primer, 1 µL of cDNA template, and nuclease-free water to volume. The thermal cycling conditions on a QuantStudio 5 Real-Time PCR System (Applied Biosystems) were: 95°C for 5 min; followed by 40 cycles of 95°C for 10 s and 60°C for 30 s; and a final melt curve stage of 95°C for 15 s, 60°C for 60 s, and 95°C for 15 s. All reactions were performed in triplicate. A melt curve analysis was performed at the end of each run to confirm primer specificity and the absence of primer dimers. The β-actin gene was used as the endogenous reference for normalization. The relative expression level of each target gene was calculated using the 2^^–ΔΔCt^ method.Table 3. Primer sequences for quantitative PCR analysis of immune-related genes.Table 3 dummy alt textTarget GenePrimer Sequence (5′→3′)β-actinF: GCCAACAGAGAGAAGATGACACR: GTAACACCATCACCAGAGTCCAIFN-γF: ATGTAGCTGACGGTGGACCTR: ACGCCATCAGGAAGGTTGTTIL2F: ATCTTTGGCTGTATTTCGGTAGR: CTGGGTCTCAGTTGGTGTGTAGIL4F: GTGCCCACGCTGTGCTTACR: AGGAAACCTCTCCCTGGATGTCIL6F: CTCCTCGCCAATCTGAAGTCR: GGCACTGAAACTCCTGGTCTIL10F: CGCTGTCACCGCTTCTTCAR: TCCCGTTCTCATCCATCTTCTCIL12F: TTGCCGAAGAGCACCAGCCGR: CGGTGTGCTCCAGGTCTTGGGIL17AF: CTCCTCTGTTCAGACCACTGCR: ATCCAGCATCTGCTTTCTTGATGF-βF: CCGACACGCAGTACACCAAGR: CAGGCACGGACCACCATAT
Lesion scoring and histopathology
On day 6 post-challenge, intestinal lesions were scored (0–4) using the modified Johnson system as described in Section 4.2. Mean scores per group were compared statistically. For histology, intestinal samples from three birds per group (Groups 1, 4, 7, 8; see Table 2 for group definitions) were fixed in 10% formalin, processed, and H&E-stained for evaluation.
Gut microbiota profiling post-challenge
Intestinal contents from the lower small intestine and ceca of five birds per group were collected at 30 days (6 days post-challenge), snap-frozen, and stored at –80°C. Bacterial composition was assessed by 16S rDNA amplicon sequencing (V3-V4 region). Bioinformatic analysis followed the same pipeline described in Section 4.3, using QIIME2 (v2021.4) to calculate alpha and beta diversity indices.
Experiment 4: Evaluation of immune protection conferred by the attenuated precocious strain
Experimental design and immunization procedure
To evaluate the immune protection conferred by the attenuated precocious strain, a total of 140 SPF chickens were randomly allocated at 3 days of age into seven groups (n = 20 per group), including three immunized groups (Groups 1-3), three non-immunized challenge control groups (Groups 4-6), and one blank control group (Group 7), as detailed in Table 4. Chickens in the immunized groups received a primary oral immunization with 200 sporulated oocysts of the attenuated precocious strain per bird. Secondary and tertiary immunizations were achieved through controlled natural exposure. Briefly, after primary immunization, birds were housed in cages on paper liners. The shedding of oocysts was confirmed by microscopic examination of fecal samples. The chicks then received booster immunizations by naturally pecking and ingesting the progeny oocysts shed onto these paper liners. The liners were replaced after each shedding cycle to provide fresh oocysts for the subsequent immunization.Table 4. Experimental design for evaluating the protective efficacy of the precocious E. brunetti strain.Table 4 dummy alt textGroupTreatmentBirds (n)Challenge at 24 Days of AgeStrainDose (Oocysts)1Immunized + EB-ZZ Challenge20EB-ZZ5 × 10⁴2Immunized + EB-BD1 Challenge20EB-BD15 × 10⁴3Immunized + EB-BD2 Challenge20EB-BD25 × 10⁴4EB-ZZ Challenge Only20EB-ZZ5 × 10⁴5EB-BD1 Challenge Only20EB-BD15 × 10⁴6EB-BD2 Challenge Only20EB-BD25 × 10⁴7Blank Control (Unchallenged)20——Note: All immunized groups received a primary oral dose of 200 sporulated oocysts of the precocious strain at 3 days of age, followed by natural exposure to shed oocysts.
Challenge and assessment of protective efficacy
At 21 days post-primary immunization (24 days of age), chickens in Groups 1-6 were challenged with the corresponding geographical E. brunetti strains at a dose of 5 × 10⁴ oocysts per bird, as specified in Table 4. Post-challenge protection was assessed by evaluating survival rate (daily mortality), body weight gain (measured pre- and post-challenge), intestinal lesion scores at 6 days post-challenge (using the modified Johnson and Reid system described in Section 4.2), and oocyst reduction rate (based on fecal oocyst output quantified between 120 and 192 h post-challenge via the McMaster method). Statistical comparisons were performed as detailed in Section 7.
Statistical analysis
All data are presented as mean ± standard error (SE). Statistical analyses were performed using GraphPad Prism software (Version 9.0). Multiple group comparisons were performed using analysis of variance (ANOVA), followed by Tukey’s honest significant difference (HSD) test for post hoc comparisons. The significance level was set at P < 0.05. The experimental unit was the individual bird for all clinical, pathological, and immunological parameters.
Results
Isolation, molecular identification, and phylogenetic analysis of geographic strains
Three geographic strains of E. brunetti (EB-ZZ, EB-BD1, and EB-BD2) were successfully isolated and purified via single-oocyst techniques. Morphological examination confirmed typical E. brunetti oocyst morphology, with mean sizes of 26.06 × 21.11 μm (EB-ZZ), 24.25 × 20.32 μm (EB-BD1), and 26.46 × 20.24 μm (EB-BD2), corresponding to shape indices of 1.26, 1.21, and 1.30, respectively. The purity and species identity were further confirmed by species-specific qPCR. Phylogenetic analysis based on ITS-1 sequences demonstrated that all three strains clustered within a distinct E. brunetti clade (Fig. 1).Fig. 1. Phylogenetic analysis showing the clustering of the isolated geographic strains (EB-ZZ, EB-BD1, EB-BD2) within a distinct Eimeria brunetti clade.Fig 1 dummy alt text
Biological characteristics of geographic strains
The prepatent period remained consistent (118–122 h) across all geographic strains. Reproductive capacity, however, varied markedly. As shown in the oocyst shedding dynamics (Fig. 2), the EB-BD2 strain consistently exhibited the total highest oocyst output, particularly at the 2,000-oocyst dose, whereas EB-ZZ and EB-BD1 showed moderate productivity. Despite these differences in yield, all strains shared a similar shedding pattern, with peak output occurring between days 6 and 7 post-inoculation.Fig. 2. Total oocyst output per chicken of three geographic Eimeria brunetti strains.(a) EB-ZZ, (b) EB-BD1, (c) EB-BD2.Fig 2 dummy alt text
Sporulation efficiency was critically influenced by litter moisture. A moisture content of 25% provided the optimal balance, yielding the highest sporulation rate (exceeding 90% after 60 h of incubation) while preserving oocyst structural integrity. In contrast, both higher (≥35%) and lower (10-15%) moisture levels significantly suppressed sporulation or caused substantial oocyst rupture.
Pathogenicity of geographic strains and impact on gut microbiota
Pathogenicity assessment revealed clear dose-dependent effects and strain-specific variation (Table 5). The EB-ZZ strain induced the most severe intestinal lesions, whereas EB-BD2 was associated with the highest mortality rate (10%) at a dose of 5 × 10⁴ oocysts per bird.Table 5. Pathogenicity of E. brunetti geographical strains across different inoculation doses.Table 5 dummy alt textGroupStrainDose (oocysts/bird)Average Weight Gain (g)†Relative Weight Gain (%)Mean Lesion Score †1EB-ZZ2.5 × 10^4^−21.70 ± 1 5.80^c^−13.902.50 ± 0.55^ab^2EB-ZZ5 × 10^4^−21.50 ± 18.91^c^−13.772.05 ± 0.52^bc^3EB-ZZ10 × 10^4^−55.5 ± 13.48^d^−35.552.90 ± 0.49^a^4EB-BD12.5 × 10^4^−57.0 ± 14.86^d^−36.521.70 ± 0.40^bcd^5EB-BD15 × 10^4^−58.4 ± 9.47^d^−37.412.05 ± 0.98^bcd^6EB-BD110 × 10^4^−68.6 ± 9.26 ^d^−43.951.60 ± 0.54^cd^7EB-BD22.5 × 10^4^82.50 ± 9.13^b^52.821.30 ± 0.46^d^8EB-BD25 × 10^4^64.4 ± 16.86^b^41.262.05 ± 0.52^bcd^9EB-BD210 × 10^4^6.9 ± 18.74^c^4.422.30 ± 0.56^abc^10Control0156.1 ± 13.44^a^1000^e^†Data are presented as mean ± SE. Values within a column for "Average Weight Gain" and "Mean Lesion Score" with different superscript letters are significantly different (P < 0.05). The "Relative Weight Gain" is provided for descriptive purposes and was not subjected to separate statistical testing.
Histopathological examination revealed a clear tissue tropism of E. brunetti. The parasite primarily infected the ileum and rectum, causing severe epithelial necrosis, hemorrhage, and substantial oocyst presence in a dose-dependent manner. Notably, the duodenum remained unaffected across all groups, and jejunal involvement was only observed at the highest infection dose (Fig. 3).Fig. 3. Eimeria brunetti exhibits a predominant tropism for the lower intestine.Representative histopathological sections of the (A) duodenum, (B) jejunum, (C) ileum, and (D) rectum from chickens. Group designations: (a) Blank control; (b-d) EB-ZZ strain at 2.5 × 10⁴ (b), 5 × 10⁴ (c), and 1 × 10⁵ (d) oocysts per bird. Pathological markers: Schizonts (S), Erythrocytes (E), Oocysts (O); epithelial necrosis (arrowheads). H&E staining. Scale bars: 500 μm (A); 200 μm(B); 100 μm (C, D).Fig 3 dummy alt text
Furthermore, infection with E. brunetti altered the cecal microbiota in a dose-dependent manner. A low infection dose (2.5 × 10⁴ oocysts) significantly increased alpha diversity indices (Observed ASVs and Chao1) compared to the uninfected control(P < 0.05), whereas higher doses (5 × 10⁴ and 1 × 10⁵ oocysts) suppressed this effect, returning diversity indices to levels comparable to the control. These shifts in diversity, along with changes in community structure and taxonomic composition, are detailed in Fig. 4.Fig. 4. Eimeria brunetti infection alters the microbiota composition in the lower small intestine at both phylum and genus levels. Microbial community profile showing (a) relative abundance at the phylum level and (b) relative abundance at the genus level. Groups: A (EB-ZZ-1, 2.5 × 10⁴ oocysts), B (EB-ZZ-2, 5 × 10⁴ oocysts), C (EB-ZZ-3, 1 × 10⁵ oocysts), and N (Blank control). Infection led to a clear shift in microbial population structure compared to the control.Fig 4 dummy alt text
Cross-protective efficacy of geographical strains and associated immune responses
Protection against challenge
Successive immunizations with all three geographic strains progressively reduced oocyst shedding and induced strong protective immunity. As exemplified by the EB-ZZ strain, immunization conferred sterile immunity against homologous challenge and near-complete cross-protection against heterologous strains (EB-BD1 and EB-BD2), with oocyst reduction rates of 100% and 99.85%, respectively (Table 6). All immunized chickens were fully protected against mortality and maintained body weight gain and intestinal integrity comparable to uninfected controls. In stark contrast, non-immunized challenged groups suffered severe weight loss and intestinal lesions (Table 7). Immunization with the EB-BD1 and EB-BD2 strains, assessed under an identical experimental protocol, elicited a similarly robust and broad cross-protective efficacy. Detailed data on oocyst reduction rates, post-challenge weight gain, and lesion scores for these strains are provided in Supplementary Tables S1 and S2.Table 6. Cross-protective efficacy of EB-ZZ strain immunization against homologous and heterologous challenges.Table 6 dummy alt textGroupImmunization StrainChallenge StrainOocyst Output (× 10^5^)Oocyst Reduction Rate (%)1EB-ZZEB-ZZ0.001002EB-ZZEB-BD10.001003EB-ZZEB-BD22.4099.854-EB-ZZ1,002.52-5-EB-BD1751.70-6-EB-BD21,619.88-Note: Oocyst output represents the cumulative shedding from days 5 to 9 post-challenge. Reduction rates were calculated against the corresponding challenge control group (Groups 4, 5, or 6).Table 7. Clinical protection conferred by EB-ZZ strain immunization.Table 7 dummy alt textGroupImmunization StrainChallenge StrainAverage Weight Gain (g)Relative Weight Gain (%)Mortality (%)Lesion Score1EB-ZZEB-ZZ175.80 ± 28.79^a^88.0800.15 ± 0.18^a^2EB-ZZEB-BD1166.50 ± 34.63^a^83.4200.25 ± 0.29^a^3EB-ZZEB-BD2173.80 ± 29.36^a^87.0700.19 ± 0.19^a^4-EB-ZZ13.10 ± 20.35^c^6.5610%2.28 ± 0.35^b^5-EB-BD1−1.20 ± 16.08^c^−6.0101.96 ± 0.45^b^6-EB-BD238.20 ± 22.37^b^19.3801.88 ± 0.37^b^7EB-ZZ-200.50 ± 15.87^a^100.4500.008--199.60 ± 34.40^a^100.0000.00Note: Values within a column with different superscript letters (a, b, c) differ significantly (P < 0.05). Relative weight gain is presented as a percentage of the Blank Control group (Group 8).
Humoral and cellular immune responses
This protective immunity was associated with the systemic activation of both humoral and cellular immune responses. On the humoral side, ELISA analysis revealed a time-dependent dynamic of serum IgY levels in chickens immunized with EB-ZZ (Fig. 5). While detectable IgY at 3 days of age was likely influenced by maternal antibodies, a significant and continual increase was observed following successive immunizations. The IgY level peaked significantly at 24 days of age (P < 0.05), markedly exceeding levels at other time points and those in the blank control group, before beginning to decline by day 30.Fig. 5. Kinetics of serum IgY levels following EB-ZZ immunization. Significant differences among groups are indicated by different letters (P < 0.05).Fig 5 dummy alt text
Cellular immunity was concurrently engaged, as evidenced by the transcription profile of cytokines in the rectal tissue (Fig. 6). qPCR analysis revealed a clear overall trend of transcriptional upregulation for most pro-inflammatory cytokines (including IL-2, IL-6, IFN-γ, IL-17A, and IL-12) from day 10 to 24 post-immunization. The anti-inflammatory cytokine IL-4 followed a similar upward trend, whereas IL-10 levels decreased after day 17. This transient and coordinated cytokine profile suggests a dynamically regulated cellular immune response induced by EB-ZZ immunization.Fig. 6. Relative expression levels of pro-inflammatory cytokines in the ceca of chickens immunized with EB-ZZ. Significant differences among groups are indicated by different letters (P < 0.05).Fig 6 dummy alt text
Maintenance of gut microbiota stability post-challenge
Immunization with EB-ZZ maintained gut microbiota stability after both homologous and heterologous challenges, in stark contrast to the significant dysbiosis observed in non-immunized infected birds (PC group) (Fig. 7, Fig. 8).Fig. 7. Effects of EB-ZZ immunization and Eimeria challenge on the microbiota composition in the lower small intestine. (a) Phylum-level composition. (b) Genus-level composition.Groups: IC_ZZ (Immunized & EB-ZZ challenged), IC_BD1 (Immunized & EB-BD1 challenged), IC_BD2 (Immunized & EB-BD2 challenged), IC (Immunized Unchallenged), PC (Non-immunized Challenged, pooled challenge controls), NC (Non-challenged Blank Control).Fig 7 dummy alt textFig. 8Effects of EB-ZZ immunization and Eimeria challenge on cecal microbiota composition. (a) Phylum-level composition. (b) Genus-level composition.Groups: IC_ZZ (Immunized & EB-ZZ challenged), IC_BD1 (Immunized & EB-BD1 challenged), IC_BD2 (Immunized & EB-BD2 challenged), IC (Immunized Unchallenged), PC (Non-immunized Challenged, pooled challenge controls), NC (Non-challenged Blank Control).Fig 8 dummy alt text
In the cecum, while no significant differences were observed in alpha diversity indices (ASVs, Shannon, Simpson, Chao1), the PC group consistently exhibited lower values across all metrics. The microbial structure of the PC group was distinct, characterized by a decreased Firmicutes/Bacteroidota ratio, an increase in the relative abundance of Barnesiella and Escherichia-Shigella, and a reduction in beneficial genera like Faecalibacterium. In contrast, the microbial profiles of all immunized groups (IC_ZZ, IC_BD1, IC_BD2) were virtually indistinguishable from those of the healthy blank control (NC) and immunized unchallenged (IC) groups.
In the lower small intestine, alpha diversity indices also showed no significant differences among groups. However, the microbial composition revealed more nuanced shifts. The PC group was marked by a lower relative abundance of Firmicutes. Notably, groups immunized with EB-ZZ and EB-BD1 (IC_ZZ, IC_BD1) exhibited a potentially beneficial profile, with a higher abundance of Firmicutes and a lower abundance of Proteobacteria compared to other groups. At the genus level, these immunized groups showed a higher relative abundance of Ligilactobacillus. The microbial structure of the immunized unchallenged group (IC) closely resembled that of the healthy control (NC), indicating that immunization itself did not induce substantial dysbiosis.
Protective efficacy of the attenuated precocious strain
Immunization with a single attenuated precocious strain provided strong cross-protection against all heterologous geographic strains challenged. No clinical signs or mortality were observed in any immunized chickens post-challenge. Notably, oocyst reduction rates were consistently high, ranging from 93.61% against EB-ZZ to over 99.8% against both EB-BD1 and EB-BD2 (Table 8). Furthermore, immunized birds maintained significantly higher weight gain and lower intestinal lesion scores compared to their respective non-immunized challenged controls (Table 8). These results confirm that the precocious strain serves as a safe and broadly effective vaccine candidate, capable of minimizing intestinal damage and growth impairment caused by diverse E. brunetti infections.Table 8. Cross-protective efficacy of the attenuated precocious strain against heterologous challenges with geographic E. brunetti strains.Table 8 dummy alt textGroupImmunizationChallenge StrainOocyst Reduction Rate (%)Relative Weight Gain (%)Lesion Score1Precocious StrainEB-ZZ93.6184.450.38 ± 0.26^a^2Precocious StrainEB-BD199.8788.420.18 ± 0.20^a^3Precocious StrainEB-BD299.9278.790.21 ± 0.19^a^4-EB-ZZ-0.191.91 ± 0.86^b^5-EB-BD1-3.631.66 ± 0.59^b^6-EB-BD2-5.351.63 ± 0.66^b^7---1000Note: Values within the Lesion Score column with different superscript letters (a, b) differ significantly (P < 0.05).
Discussion
Epidemiological background and significance of E. brunetti
The significance of E. brunetti as a pathogen in the Chinese poultry industry is being redefined. Our recent nationwide survey (Kang et al., 2024) has established a high prevalence (34.20%) of E. brunetti in yellow-feathered broilers, a finding which challenges the historical view of it being a low-prevalence pathogen in broilers (Geng et al., 2021). This emerging trend is corroborated by Liao et al. (2024), who reported a substantial prevalence (21.61%) in vaccinated broiler flocks and highlighted the clinical significance of E. brunetti in mixed infections. Consequently, while current control in yellow-feathered broiler production predominantly relies on tetravalent live vaccines targeting E. tenella, E. acervulina, E. maxima, and E. necatrix, the collective evidence positions E. brunetti as a tangible and emerging threat that falls outside the protective coverage of this widely adopted immunization strategy. This paradigm shift and the clear gap in protection necessitate a deeper biological and immunological understanding of prevalent strains, which formed the core objective of this study.
Biological characteristics of geographic strains
We established that the three geographic strains exhibited highly consistent prepatent periods (118–122 h), with minimal variation, indicating a stable biological trait across diverse geographical origins. A pivotal finding was the identification of 25% litter moisture as the optimum for oocyst sporulation. Both elevated and suboptimal moisture levels were detrimental; high humidity inhibited the sporulation process, while excessively dry conditions (below 15%) led to oocyst dehydration, structural damage, and ultimately, a drastic reduction in viable oocysts. This finding underscores the critical role of precise environmental control in maximizing the efficacy of live oocyst-based vaccines, a factor sometimes overlooked in field applications.
Pathogenicity assessment
All three geographic strains proved to be highly pathogenic, with EB-ZZ and EB-BD1 inducing the most severe intestinal lesions. Histopathological examination confirmed the ileum and rectum as the primary sites of infection, which is consistent with the established pathogenesis of E. brunetti (Hein, 1974). The observation of jejunal involvement at high inoculation doses indicates a dose-dependent expansion of tissue tropism. Furthermore, infection with E. brunetti induced significant dysbiosis in the cecal microbiota. The increase in alpha diversity and the enrichment of potential pathogens such as Escherichia-Shigella and Bacteroides are consistent with findings from other coccidial infections (Bortoluzzi et al., 2019). Such dysbiosis is increasingly recognized as a key contributor to intestinal barrier dysfunction and malabsorption, extending the pathogenic impact of Eimeria beyond direct epithelial damage (Chen et al., 2025). These microbial shifts likely contribute to the clinical manifestations of diarrhea and increase susceptibility to secondary bacterial infections, reinforcing the concept that coccidiosis disrupts intestinal homeostasis.
Immunogenicity and cross-protection
Our results confirm the strong immunogenicity of E. brunetti and, more importantly, reveal a key immunological basis for control: the presence of conserved protective antigens, as demonstrated by the robust cross-protection among geographic strains, with detailed efficacy data for all strains provided in this study (Tables 6, 7; Supplementary Tables S1, S2). The immunization protocol elicited a coordinated cytokine response, suggesting a balanced Th1/Th2 response that is crucial for effective anti-coccidial immunity (Cope et al., 2011; Chen et al., 2022). Furthermore, immunization stimulated a significant increase in serum IgY levels. While the definitive role of systemic antibodies in anti-coccidial immunity is complex, the induction of specific IgY has been correlated with protection, and passive immunization with IgY has been shown to confer resistance against Eimeria infection (Lee et al., 2009). Beyond the adaptive immune responses, immunization with EB-ZZ also maintained gut microbiota stability in both the lower small intestine and cecum post-challenge, in stark contrast to the dysbiosis observed in non-immunized controls. The robust cross-protection observed among geographically distinct strains is particularly promising for vaccine development, as it suggests that a single vaccine strain could confer broad coverage against the prevalent genetic diversity of E. brunetti in China, simplifying vaccine formulation and deployment.
The variations in microbial profiles among birds immunized and challenged with different strains suggest that the protective outcome is mediated through an interaction between the host‘s immune status and the specific biological characteristics of the challenge strain. This suggests that the protective immunity conferred extends to the preservation of intestinal microbial homeostasis, a critical component of gut health and barrier function (Chen et al., 2025). Most notably, the attenuated precocious strain provided excellent and broad protection against heterologous geographic strains within the same species. Corroborating this concept, our data on the precocious strain demonstrate that a single attenuated line can induce broad cross-protection against diverse strains of E. brunetti, a finding that demonstrates the successful application of this established principle to a specific and economically significant species (Shirley and Millard, 1986). These results solidify its potential as a vaccine candidate capable of addressing the pathogen's geographic diversity.
Conclusion
In summary, this study provides crucial insights into the biology and immunology of E. brunetti in Chinese yellow-feathered chickens. The established high prevalence and confirmed pathogenicity of E. brunetti geographic strains, counterbalanced by the demonstrated robust cross-protection (particularly conferred by the precocious line), highlight the urgent need to integrate E. brunetti-specific strategies into coccidiosis control programs for this economically important sector.
CRediT authorship contribution statement
Jia-Hui Kang: Writing – original draft, Methodology, Investigation, Data curation. Jia-Jia Tan: Methodology. Rui-Zhen Wang: Methodology, Investigation. Xiao-Ling Deng: Methodology. Zi-Ying He: Methodology. Xiao Lu: Data curation. Li-Dang Liu: Writing – review & editing. Ya-Biao Weng: Investigation. Rui-Qing Lin: Writing – review & editing, Supervision, Funding acquisition, Conceptualization.
Disclosures
All authors of this manuscript hereby declare that they have no competing financial interests or personal relationships that could have influenced the work reported in this paper. The research was supported by a public grant (Guangdong Province R&D Program, No. 2019B020218004), which involved no conflict of interest. The industry-academic collaboration in this study was conducted solely for scientific purposes.
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1Blake D.P.Knox J.Dehaeck B.Huntington B.Rathinam T.Ravipati V.Ayoade S.Gilbert W.Adebambo A.O.Jatau I.D.Re-calculating the cost of coccidiosis in chickens Vet. Res.5120201153292827110.1186/s 13567-020-00837-2PMC 7488756 · doi ↗ · pubmed ↗
- 2Bortoluzzi C.Vieira B.S.Hofacre C.Applegate S.Effect of different challenge models to induce necrotic enteritis on the growth performance and intestinal microbiota of broiler chickens Poult. Sci.982019280028123087774910.3382/ps/pez 084 · doi ↗ · pubmed ↗
- 3Chapman H.D.Milestones in avian coccidiosis research: a review Poult. Sci.9320145015112460484110.3382/ps.2013-03634 · doi ↗ · pubmed ↗
- 4Chen C.Zhang Y.Liu J.Wang M.Lu M.Xu L.Yan R.Li X.Song X.An Eimeria maxima antigen: its functions on stimulating Th 1 cytokines and protective efficacy against coccidiosis Front. Immunol.13202287201510.3389/fimmu.2022.872015 PMC 916335035669766 · doi ↗ · pubmed ↗
- 5Chen P.Rehman M.U.He Y.Li A.Jian F.Zhang L.Huang S.Exploring the interplay between Eimeria spp. Infection and the host: understanding the dynamics of gut barrier function Vet. Q.451202512210.1080/01652176.2025.2452169 PMC 1174915139831548 · doi ↗ · pubmed ↗
- 6Cope A.Le Friec G.Cardone J.Kemper C.The Th 1 life cycle: molecular control of IFN-γ to IL-10 switching Trends. Immunol.3220112782862153162310.1016/j.it.2011.03.010 · doi ↗ · pubmed ↗
- 7Geng T.Ye C.Lei Z.Shen B.Fang R.Hu M.Zhao J.Zhou Y.Prevalence of Eimeria parasites in the Hubei and Henan provinces of China Parasitol. Res.12020216556633340962610.1007/s 00436-020-07010-w · doi ↗ · pubmed ↗
- 8Hein H.E. brunetti: pathogenic effects in young chickens Exp. Parasitol.361974333341443033410.1016/0014-4894(74)90073-3 · doi ↗ · pubmed ↗
