Lnc1267-hnRNP U interaction promotes radioresistance by inhibiting apoptosis via attenuated RelA/p65 Ser536 phosphorylation
Zhenhua Qi, Ying Fan, Xin Liu, Dan Cai, Chuxian Lin, Yaqiong Li, Hong Zhang, Meng Jia, Jixia Han, Yunqi Mo, Maoxiang Zhu, Liping Shen, Qi Wang, Zhidong Wang
TL;DR
A conserved lncRNA called lnc1267 helps cancer cells resist radiation by inhibiting apoptosis through a specific NF-κB signaling pathway.
Contribution
This study identifies lnc1267 as a novel conserved lncRNA that regulates tumor radioresistance via NF-κB-mediated pro-apoptotic signaling.
Findings
Radiation exposure represses lnc1267, which activates NF-κB pro-apoptotic signaling through RelA/p65 phosphorylation.
lnc1267 confers radioresistance in cancer cells, while its downregulation increases radiosensitivity across cancer types.
p53 activates transcriptional suppression of lnc1267, releasing hnRNP U to promote RelA/p65 phosphorylation and pro-apoptotic signaling.
Abstract
Radiotherapy efficacy is frequently limited by tumor radioresistance, with dysregulated apoptosis playing a pivotal role. While NF-κB is a well-established mediator of cancer radioresistance (primarily through anti-apoptotic mechanisms), the paradoxical pro-apoptotic function of radiation-induced NF-κB activation remains poorly understood. Emerging evidence suggests that certain conserved lncRNAs may function analogously to housekeeping genes during tumor progression; however, their involvement in radiation-triggered apoptotic pathways—particularly NF-κB-dependent pro-apoptotic signaling—during radiotherapy remains unexplored. This study aims to elucidate the functional role and molecular mechanisms through which a novel conserved lncRNA confers cancer radioresistance by regulating the NF-κB-mediated pro-apoptotic pathway. Herein, we identify lnc1267 as a highly conserved lncRNA (80.43%…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6- —http://dx.doi.org/10.13039/501100001809National Natural Science Foundation of China
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsCancer-related molecular mechanisms research · NF-κB Signaling Pathways · Immune Response and Inflammation
Introduction
Radiotherapy remains one of the primary treatment modalities for cancer, yet its efficacy is consistently challenged by tumor radioresistance [1]. Apoptosis serves as a pivotal executor of radiation-induced cytotoxicity, governed by an intricate network of signaling cascades that present actionable targets for circumventing radiotherapy resistance [2]. The NF-κB pathway operates as a master radiation-responsive regulator in cancer therapy, dynamically balancing pro-apoptotic and anti-apoptotic signalling cascades in tumor cells [3, 4]. NF-κB represents a widely expressed transcription factor family characterized by an evolutionarily conserved Rel domain. The family regulates diverse cellular processes, including apoptosis, through the formation of dimers composed of subunits such as RELA/p65, RELB, NF-κB1/p50, NF-κB2/p52, and c-Rel [5]. NF-κB is widely recognized as a pivotal regulator in tumorigenesis, largely attributable to its potent anti-apoptotic activity in cancer cells. Extensive studies have demonstrated that suppressing NF-κB signaling enhances the sensitivity of cancer cells to apoptosis triggered by radiotherapy and chemotherapy [6]. However, emerging evidence also suggests that activation of NF-κB can suppress tumor growth and promote the susceptibility of tumor cells to apoptosis induced by agents such as RITA (an anticancer small molecule) [7, 8]. Notably, this pro-apoptotic function is closely associated with the specific phosphorylation modification at Ser536 of the core subunit RelA/p65 [9]. For example, studies have confirmed that ionizing radiation (IR) induces RelA/p65 Ser536 phosphorylation in various types of cancer cells, such as colorectal cancer cells, subsequently activating pro-apoptotic genes like PUMA and triggering apoptosis and senescence pathways [10, 11]. However, the molecular mechanisms governing IR-induced RelA/p65 Ser536 phosphorylation and its consequent pro-apoptotic effects remain incompletely characterized.
Long non-coding RNAs (lncRNAs) are defined as transcripts exceeding 200 nucleotides with limited or no protein-coding capacity [12]. Recent studies have established lncRNAs as critical regulators of radiation-induced apoptotic pathways [13]. Mechanistic studies have revealed that through interactions with proteins, they participate in various gene regulatory mechanisms including chromatin remodeling, transcriptional interference, and post-transcriptional regulation [14]. Certain lncRNAs have been demonstrated to interact with NF -κB components, thereby influencing apoptosis. For instance, lncRNA NKILA-mediated suppression of NF-κB activation specifically enhances cytotoxic T lymphocyte sensitivity to activation-induced cell death (AICD) [15]. However, the low evolutionary conservation of lncRNAs presents significant challenges for clinical translation [16]: only approximately 14% of mouse lncRNAs possess human homologs, while fewer than 2% exhibit cross-species functional equivalence [17, 18]. This evolutionary divergence not only complicates preclinical validation but also obscures the identification of therapeutically relevant lncRNAs with cross-species applicability [19]. The field of radiation biology particularly lacks studies on conserved lncRNAs, with most research focusing on species-specific lncRNAs (e.g., TUG1 in bladder cancer, which is upregulated by IR and enhances radiosensitivity through HMGB1 targeting) whose functions are restricted to their respective systems [20]. Therefore, identifying conserved lncRNAs with cross-species functional relevance (termed “ultraconserved regions”) has become an urgent priority [21]. Nevertheless, the current understanding of evolutionarily conserved lncRNA functions in IR-induced apoptosis remains limited. Additionally, although certain lncRNAs have been demonstrated to be key regulators of the NF-κB signaling pathway and participate in the pathogenesis of various diseases (e.g., cancer) [22], their involvement in NF-κB-mediated pro-apoptotic signal transduction under IR stress remains mechanistically unclear.
In our previous microarray analysis of irradiated mouse PBMCs, we identified a functionally uncharacterized lncRNA (NONMMUT001267.2) [23], which we designated as lnc1267. This study first confirmed the existence of highly homologous lnc1267 transcripts in both human and mouse. Functional investigations revealed that IR suppresses lnc1267 expression in a p53-dependent manner, and its downregulation induces apoptosis and enhances radiosensitivity through activation of the RelA/p65 Ser536 phosphorylation pathway. Mechanistically, we discovered that lnc1267 binds hnRNP U protein to regulate the hnRNP U-IKKβ interaction, thereby influencing RelA/p65 Ser536 phosphorylation. Our work not only identifies lnc1267 as the first reported human-mouse homologous lncRNA that suppresses cancer cell radioresistance by modulating IR-induced apoptosis, but also reveals a novel NF-κB-mediated pro-apoptotic mechanism involving RelA/p65 Ser536 phosphorylation under IR stress, establishing a promising therapeutic target to overcome radiotherapy resistance.
Materials and methods
Cell culture and irradiation
Human colon cancer HCT116 (RRID: CVCL_0291) and cervical cancer HeLa (RRID: CVCL_0030) were purchased from the Chinese Academy of Sciences Cell Bank (China) and cultured them in a humidified incubator under 5% CO_2_ at 37℃. HCT116 and HeLa cells were cultured in RPMI-1640 medium (HyClone, USA), and L1210 and NIH/3T3 were cultured in high-glucose DMEM medium (HyClone, USA). The mediums both contained penicillin (100 units/ml), streptomycin (100 µg/ml) (HyClone, USA) and 10% fetal bovine serum (FBS) (ExCell Bio, China). The cells were placed in six-well plates and subsequently irradiated using ^60^Co γ-radiation with 69.6 cGy/min at room temperature in the AMMS Radiation Laboratory.
5’ and 3’ RACE
The total RNA from cells was extracted by using TRIzol reagent (Sigma, USA). The concentration and purity of RNA were determined detected using NanoDrop 2000 (ThermoFisher Scientific, USA). Genomic DNA was removed through incubating for 30 min at 37 °C with RNase-free DNase I (Beyotime Biotechnology, China). The 5′ and 3′ rapid amplification of complementary DNA ends (RACE) using the SMARTer^®^ RACE 5′/3′ Kit was performed in accordance with the manufacturer’s instructions (Clontech, USA). Briefly, two rounds of nest PCR amplification were performed with universal primers and gene special primers (Tsingke Biotechnology, China). The RACE PCR products were subjected to electrophoresis with a 1.5% agarose gel. Bi-directional DNA sequencing was performed using the indicated primers end after the amplified bands were purified and cloned into Stellar Competent Cells provided by the protocol. The universal primers and gene special primers used in RACE experiments are listed in Supplementary Materials.
5’ exonuclease digestion assay
5’-Phosphate-dependent exonuclease digestion assay was performed with a terminator 5’-phosphatedependent exonuclease kit according the manufacturer’s instructions (Lucigen, USA). Briefly, total RNA isolated from PBMC of healthy human and mouse was treated with the exonuclease, which specifically digests RNA species with a 5’-monophosphate end, at 30˚C for 60 min. The isolation and quantification of the 5’-capped mRNA were performed as in the nucleocytoplasmic separation experiment. The mRNA fraction of lnc1267, GAPDH and 28 S rRNA was analyzed through relative quantitative PCR. GAPDH and 28 S rRNA were used as positive and negative controls, respectively.
Poly(A) tail identification assay
3’-Poly(A) tails length was detected with the Poly(A) tail length assay kit (Affymetrix, USA) in accordance with the manufacturer’s instructions. Briefly, a limited number of guanosine and inosine residues were added to the 3’ ends of poly(A)-containing RNAs from PBMC of healthy human and mouse, which was performed at 37˚C for 60 min. The tailed-RNA was converted to cDNA through reverse transcription using the newly added G/I tails as the priming sites. PCR was performed using the cDNA as a template with gene-specific primers of lnc1267, 28 S rRNA and GAPDH. The bands of RT-PCR products of lnc1267, 28 S rRNA and GAPDH, which fragments was 131, 212 and 115 bp, respectively, were detected using electrophoresis on a 2% agarose gel.
Nucleocytoplasmic separation experiment
Cytoplasmic and nuclear RNA/protein was separated using the PARIS™ Kit (ThermoFisher Scientific, USA) according to the manufacturer’s instructions. The yield and quality of the RNA samples were evaluated using Western Blot and RT-qPCR. GAPDH and U6 were used as cytoplasmic and nuclear controls, respectively. The phosphatase and protease inhibitors (Roche Applied Science, USA) were added to protein supernatant separated using the PARIS™ Kit. The efficiency of nucleocytoplasmic separation was evaluated with GAPDH and Lamin B as cytoplasmic and nuclear controls by Western Blot. The methods are detailed in the Supplementary Materials.
RT-qPCR analysis
1 µg of total RNA was employed to synthesize first-strand cDNA using PrimeScriptRT reagent kit (TaKaRa, Japan). Real-time PCR analyses were performed using the iTaq™ Universal SYBR Green Supermix (Mei5 Biotechnology, China). The primer sequences are listed in Supplementary Table S1. The experiments were repeated in a 20 µL volume at least three times independently to ensure the reproducibility of the results. Amplification steps as follows: holding stage at 95℃ for 3 min; cycling stage include denaturation at 95℃ for 10 s, 55℃ for 30 s, 40 cycles. The relative expression of evaluated genes was calculated using the 2^(−ΔΔCt) method. The sequences of primary RT-qPCR primers used in this study are listed in Supplementary Table 1.
Western bot experiment
Cell pellets were lysed in RIPA containing phosphatase and protease inhibitors (Roche Applied Science, USA). The SDS-polyacrylamide gel electrophoresis was performed. The protein concentration was measured with BCA Assays (Beyotime Biotechnology, China). 20 µg of denatured proteins were separated by SDS-polyacrylamide gel electrophoresis with SDS-PAGE gel, subsequently transferred to nitrocellulose membranes and blocked with 5% skim milk for 2 h at room temperature. After blocking, 5% non-fat milk was removed, and the membranes were incubated with primary antibody used as cytoplasmic and nuclear controls for 12 h at 4 °C. The primary antibodies are listed in Supplementary Table S2. The following day, membranes were labeled with the secondary antibodies (KPL, USA) at room temperature for 2 h. The protein bands were visualized with the Image Quant 800system (Cytiva, China).
Fluorescence in situ hybridization (FISH)
Fluorescence in situ hybridization kit and Cy3-labeled lnc1267 FISH Probe MIX were purchased from RiboBio for FISH assays, which were performed in accordance with the manufacturer’s instructions (RiboBio, China). HCT116 and HeLa cells were seeded and cultured in a 24 well plate inlaid with polylysine coated coverslips. The cells were fixed and permeabilized with a mixture of 4% paraformaldehyde and 0.5% Triton X-100 for 30 min at room temperature. Subsequently the slides were blocked at 37℃ for 60 min by a mixture of blocking buffer and pre-hybridization buffer. After pre-hybridization, the slides were hybridized with hybridization buffer containing denatured Cy3-labeled antisense lnc1267 probe (2.5 uL, 20 μm) at 37℃ overnight in a humidity incubator sheltered from light. After washed with different concentrations of SSC buffer (4x, 2x, and 1x), the slides were counterstained with DAPI (ZSGB-Bio, China). These images were acquired using a fluroscence microscope (Nikon, Japan).
Apoptosis analysis
An annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) apoptosis kit (Dojindo, Japan) was used for the apoptosis assay and at least, 20,000 cells were tested in each sample using flow cytometry (BD FACSCalibur, USA). After treatment, cells were harvested, washed three times with phosphate buffered saline (PBS) and stained with Annexin V-FITC/PI. The suspension of each group was analyzed within 1 h using the flow cytometer. Annexin V-FITC mono-positive and Annexin V-FITC/PI double positive cells were counted as apoptotic cells, while only PI was positive for necrotic cells.
ChIP-qPCR
Chromatin immunoprecipitation (ChIP) was performed using the SimpleChIP Enzymatic Chromatin IP Kit with magnetic beads (Cell Signaling Technology, #9003S) per manufacturer’s guidelines. Cells (2 × 10⁷ per group) were irradiated (0–4 Gy) and harvested 48 h later. Cells were fixed with 37% formaldehyde (10 min, RT), quenched with 10× glycine (5 min), lysed in Buffer A (10 min, ice), and centrifuged (4℃, 2000 g, 5 min). The crosslinked chromatin was digested with micrococcal nuclease followed by sonication to break into 150–900 bp fragments. Chromatin was immunoprecipitated overnight at 4℃ with antibodies against IgG (Emd Millipore, S200621), or p53(Santa Cruz, sc-126X), followed by protein G magnetic beads (2 h, 4℃). Beads were washed (low-salt buffer ×3, high-salt buffer ×1), eluted (65℃, 30 min), and treated with proteinase K (65℃, 2 h) to reverse cross-links. DNA was purified and analyzed by RT-qPCR, with input percentage calculated as 2% × 2^(Ct 2% input sample – Ct IP sample)^, and the relative enrichment of p53-bound DNA fragments compared to the input and negative control (IgG) was determined to assess the specific binding of p53 to target genomic regions under different irradiation conditions.
RNA stability assay
To investigate the effects of irradiation on the stability of lnc1267 mRNA, HCT116 cells were exposed to a single dose of 4 Gy γ rays or sham irradiation. After 48 h, the cells were incubated with 5 µg/ml Act D, a transcriptional inhibitor. Subsequently, the cells were harvested at 0, 1, 2, 4, and 8 h following the addition of Act D. Total RNA samples were then extracted, and RT-qPCR was used to determine the changes in lnc1267 expression over time.
Cell proliferation assay
The Cell Counting Kit-8 (CCK-8, Dojindo Laboratories, Japan) assay was utilized to evaluate cell proliferation capability according to the manufacturer’s protocols. Cells were plated in 96-well plates with a 100 µL volume medium per well, and experiments were performed with five replicates for each set of samples. The cell viability per well was evaluated by absorbance values at a wavelength of 450 nm using a Tecan’s Sunrise absorbance microplate reader (Sunrise, Switzerland) at the indicated time.
Colony formation assay
Cells were plated in 6-well plates and incubated in 2 ml medium containing 10% FBS in a humidified incubator under 5% CO_2_ at 37 °C. During cell culture, medium was replaced every 3–5 day. The cells were fixed with methanol and stained with Giemsa after 11–14 days. The number of colonies, defined as > 50 cells/colony, was recorded and scanned [24]. The clonal survival fraction curve after ionizing irradiation was plotted using the single-hit multitarget model (SF = 1–[1–e^–D/D0^] ^N^) after ionizing irradiation. The radiosensitivity parameters were calculated using SPSS software based on the formula previously described [25]. Radiosensitivity parameters were calculated, including the mean lethal dose (D0), the quasi-threshold dose (Dq = D0*lnN), the cell survival fraction (SF), the extrapolation number (N), and the sensitization enhancement ratio (SER) which is defined as SER = Dq (control group)/Dq (treatment group). SER represents the variation of cell radiosensitivity. An SER of 1 or greater signifies increased cellular radiosensitivity following treatment, with a higher SER value denoting greater sensitivity to radiation.
Cell transfection and lentivirus infection assays
Cells were transfected 24 h after plating in an incubator. Lipofectamine 2000 (Invitrogen, USA) and jetPRIME^®^ Transfection Reagent (Polyplus transfection, France), following the manufacturer’s protocol, were used for transfection of LNA™ longRNA GapmeRs designed to knock down lnc1267 and plasmids designed to overexpress lnc1267, respectively. The locked nucleic acids (LNAs) and plasmids were synthesized by QIAGEN (USA) and Gene-Chem (China), respectively. The details of LNA sequences are shown in Supplementary Table S3. Lentiviruses expressing lnc1267 (LV-lnc1267) or negative control oligonucleotide sequences (LV-NC) were prepared by Gene-Chem (China). The DNA sequences of lnc1267 transcripts were cloned into a modified SV40 vector (Genechem, China) and packaged into the lentiviruses. The viral titer of human lentiviruses were as follows: LV-NC (7.5 × 10^8^ TU/mL), LV-lnc1267 (5 × 10^8^ TU/mL), LV-lnc1267-FL1 (5 × 10^8^ TU/mL), LV-lnc1267-FL2 (2.5 × 10^8^ TU/mL). For mouse lentiviruses, the titer were LV-NC (7.5 × 10^8^ TU/mL) and LV-lnc1267 (4.0 × 10^8^ TU/mL), respectively. The multiplicity of infection (MOI) of 10 was used for lentiviral transduction of HeLa and HCT116 cells. 24 h prior to the lentiviral transfection, the cells were seeded at 2.5 × 10^5^ cells per well in six-well plates. The next day, an optimal volume of lentivirus was added to the culture medium, and the cells were maintained in the virus-containing medium for 72 h. Subsequently, stable cell lines were selected by incubating with puromycin (2 µg/ml) for 7 days. The stably infected cells were then cultured continuously in medium supplemented with 2/3 µg/ml puromycin.
CRISPR-mediated lnc1267 knockout cell lines
The target sequences of the lnc1267 sgRNA (5’-ATAAAGGCGACTAGGACCAT-3’; 5’-AAGTCACTCGCACCTCATTT-3’) were designed using the http://crispr.mit.edu/ online tool to knockout the lnc1267 gene. In brief, the resulting sgRNA-Cas9 knockout plasmid (carrying puromycin resistance) was transfected to the HeLa and HCT116 cells using jetPRIME^®^ Transfection Reagent according to the manufacturer’s instructions. The cells were diluted into single cells in 96-well plates with the medium containing puromycin. The expression level of lnc1267 in the single-cell clone of each well was identified by RT-qPCR, and the monoclonal cell lines with stable knockout of the target gene were finally obtained.
RNA-seq and bioinformatics analysis
HCT116 and HeLa cells were harvested at 48 h after transfecting LNAs to use for RNA extraction. Three independent biological replicates were prepared for the RNA-seq analysis. The integrity of total RNA was quantified with an Agilent 2100 Bioanalyser (Agilent, USA). The cDNA libraries were prepared and sequenced according the manufacturer’s protocol of Illumina Hiseq4000 (PE150) at LC Sciences (USA). Cutadapt software was used to acquire clean reads from the raw data and map them with the human genome sequence (GRCh38). The expression abundance of known genes in different samples was calculated using fragments per kilobase of exon model per Million mapped reads (FPKM). Differentially expressed genes were defined as |log_2_foldchange|≥1 and corrected p < 0.05. The results of KEGG enrichment analysis using ggplot2 software were presented as scatter plot: RichFactor represents the number of differential genes in the KEGG/the total number of genes in the KEGG, and the greater the RichFactor value, the greater the enrichment degree of KEGG. KEGG data of differentially expressed genes were showed in Supplementary Table S4.
RNA pull-down assay
To study protein-RNA interactions, we performed an RNA Pull-Down assay using in vitro-constructed target gene probes. Key steps included: (1) constructing plasmids containing lnc1267-FL2 and LacZ gene sequences with T7 promoter-containing primers (FL2: F-GGATCCTAATACGACTCACTATAGGGCACAAAGGAGCCTTGCTAGCCACAC, R-CGGTACAGTGTATATTTTCCAATTTAGCACACATTAAAAGTGGAAAAAGAA; LacZ: F-GGATCCTAATACGACTCACTATAGGGATGACCATGATTACGGATTCACTGG, R-TTATTTTTGACACCAGACCAACTGGTAATGGTAGCGACCGGCGCTCAGCTG), amplifying probes by PCR with I-5™ 2× High Fidelity Master Mix Kit (MCLAB, Cat# I5HM-OEM, USA), verifying PCR product size by agarose gel electrophoresis, purifying, sequencing, and confirming accuracy by BLAST; (2) performing in vitro transcription and biotin labeling of PCR products using Biotin RNA Labeling Mix Kit (Roche, Cat#11685597910, Switzerland) and T7 RNA polymerase kit (Roche, Cat#10881767001, Switzerland), purifying probes, and verifying band size by formaldehyde denaturing agarose gel electrophoresis. Hela cell lysates were prepared, preconditioned with magnetic beads, and incubated with RNA probes. After washing, the beads were resuspended in protein loading buffer, denatured, and stored for later Western blot and silver stain analysis.
Silver staining and mass spectrometry analysis
To visualize and identify differential protein bands between lnc1267-FL2 and LacZ pull-down samples, silver staining was conducted using the Fast Silver Stain Kit (Beyotime, Cat#P0017S, China) according to the manufacturer’s instructions at room temperature (20–25 °C). Briefly, protein samples were separated on a 10% SDS-PAGE gel. The gel was then fixed with fixing solution for 40 min, washed once with 30% ethanol for 40 min, and rinsed twice with ultrapure water for 30 min each time. The gel was sensitized with sensitizing solution for 2 min and washed twice with ultrapure water for 1 min each time. Next, the gel was stained with silver staining solution for 10 min, rinsed once with ultrapure water for 1 min, and developed with the developer for silver staining for 3–5 min. Development was terminated with stop solution for 3–5 min, followed by washes in ultrapure water for 2–5 min. Significant differential protein bands between lnc1267-FL2 and LacZ were observed, excised, and placed in new tubes. The excised gel pieces were submitted for mass spectrometry analysis to Shanghai Genechem Co., Ltd. (China) to identify and characterize the differential proteins present within the samples. Western Blot was used to verify the results obtained from mass spectrometry.
RNA Immunoprecipitation (RIP) assay
To further validate protein-RNA interactions, trypsin-digested Hela cells (2 × 10^7 cells per sample) were lysed with plasma membrane lysis buffer containing protease and RNase inhibitors on ice for 5 min, followed by centrifugation and washing with ice-cold PBS. Nuclear membranes were lysed using a buffer with inhibitors, sonicated (40 W, 1 s on/2s off, 30 s), and incubated on ice for 30 min. Cell lysates were centrifuged, and supernatants were divided for RNA and protein input, and RIP. Agarose beads were added to supernatants and incubated at 4 °C for 30 min. Samples were centrifuged, and supernatants were incubated with 5 µg of hnRNPU (manufacturer-specified) or IgG (EMD Millipore, CS200621) for 12 h at 4 °C. Beads blocked with 0.1% BSA were added and incubated for 4 h at 4 °C. Beads were washed with RIP wash buffer containing RNase inhibitors and resuspended in buffer for Western Blot or qPCR. For qPCR, beads were treated with protease K buffer, RNA was extracted using phenol-chloroform, and reverse transcribed using PrimerScript RT reagent Kit (Takara, RR047A, Japan). qPCR was performed with 2× M5 Hiper SYBR Premix EsTaq kit (Mei5 Biotechnology, MF787-02, China). Protein-antibody binding to agarose beads was confirmed by Western Blot.
Co-immunoprecipitation (Co-IP)
To further validate protein-protein interactions, cells were supplemented with NETN buffer (comprising 300 mM NaCl, 20 mM Tris-base, 1 mM EDTA, and 0.5% (v/v) NP-40), which also contained protease inhibitors. The cells were then lysed using an ultrasonic cell disruptor operated at 1% power, with a cycle of 1 s on and 2 s off, repeated 10 times. This lysis process was carried out on ice for 30 min. Subsequently, the lysates were centrifuged at 12,000 g at 4 °C for 15 min. The supernatant was then incubated with the primary antibody at 4 °C for 12 h. Following this, additional beads were added and the incubation continued at 4 °C for another 6 h. Afterward, the samples were washed three times with NETN buffer that also contained protease inhibitors. The immunoprecipitation complexes were collected and analyzed by Western Blot.
Statistical analysis
For all of the results, the data are presented as the mean ± SD. The differences between two groups in RT-qPCR experiments and colony formation assays were compared by unpaired two-sided Student’s t-test (all experiments were performed in triplicate or more). A multi-way classification analysis of variance test was performed to assess data obtained from the CCK8 assays and hemogram analysis. *P < 0.05, **P < 0.01 or ***P < 0.001 was considered to indicate statistical significance. All statistical analyses were performed using the SPSS software (USA).
Results
Lnc1267 is a novel human/mouse homologous LncRNA
Genomic alignment of the mouse lnc1267 sequence (from NONCODE website, ID: NONMMUT001267.2) to the human genome (GRCh38) revealed a conserved homologous sequence within the KLF7 intronic region. The absence of prior annotations for this highly conserved human sequence indicates a possible existence of a novel human lncRNA lnc1267. Using intron-spanning primers for GAPDH and β-actin to control for genomic DNA contamination, we further detected lnc1267 expression via RT-PCR. Agarose gel electrophoresis of the PCR products revealed bands of expected sizes, and sequencing analysis confirmed the presence of lnc1267 transcripts in both human and mouse samples (Supplementary Fig. S1). Subsequently, the full-length transcripts of lnc1267 were assessed using 5’- and 3’-RACE analysis, and their lengths in mouse and human PBMCs were determined to be 7252nt and 7531nt, respectively (Fig. 1A). Sequence homology analysis using the NCBI BLAT Search Genome Tool demonstrated 80.43% localized sequence conservation between human and mouse lnc1267 transcripts (Fig. 1A, Supplementary Fig. S2A). Furthermore, analysis of the sequence conservation of lnc1267 using the BLAT Search Genome Tool from the UCSC website (https://genome.ucsc.edu/cgi-bin/hgBlat?command=start) further demonstrated that specific regions of lnc1267 are evolutionarily conserved across primates (humans, rhesus monkeys), rodents (mice), canids (dogs), and proboscideans (elephants) (Fig. S2B). Further analysis of the sequence characteristics of lnc1267 revealed that both human and mouse lnc1267 transcripts do not possess a 5′ cap structure, as indicated by 5′ exonuclease digestion analysis (Fig. 1B). RT‒qPCR of 3’-end tailed RNA indicated that both human and mouse lnc1267 are polyadenylated transcripts (Fig. 1C). In addition, the coding probability values of human and mouse lnc1267 transcripts predicted by using the Coding Potential Assessment Tool (CPAT) were 0.079 and 0.238, respectively. The coding capacity assessment, presented in a scatter plot, revealed that both human and mouse lnc1267 lack protein-coding capacity, as indicated by the threshold value of protein coding ability ≥ 0.364 (Fig. 1D). Taken together, these data demonstrate high sequence homology and primary structure conservation between human and mouse lnc1267 transcripts.
Fig. 1. Lnc1267 is expressed as a human/mouse homologous lncRNA transcript. A PCR product from the 5′-RACE and 3′-RACE procedures are shown by agarose gel electrophoresis. B The 5’-triphosphate cap of human/mouse lnc1267 is validated through the 5’ exonuclease digestion assay. GAPDH and 28 S rRNA acted as the positive and negative controls, respectively. “Total” means total RNA used in reverse transcription (RT), and “capped” indicates capped RNA that was digested by 5’ exonuclease during cDNA synthesis. C Detection of the poly(A) tail of human/mouse lnc1267 by RT-PCR from PBMC RNA. Total RNA was G/I tailed, reverse-transcribed, and amplified with gene-specific forward and reverse primers. 28 S rRNA and GAPDH were used as negative and positive controls, respectively. D Coding potential of the transcript in human/mouse lnc1267 and reference transcripts according to the CPAT algorithm. In the references, MALAT1, HOTAIR and XIST are lncRNAs, while the others are protein-coding genes
IR-mediated p53 activation suppresses lnc1267 transcription
To facilitate the subsequent study of lnc1267’s function, we assessed its expression profiles in seven common human cancer cell lines using RT-qPCR technology. The results indicated that lnc1267 was ubiquitously expressed across these cell lines (Fig. S3). For functional analyses to be representative, we selected HCT116 cells, which exhibit high basal lnc1267 expression, and HeLa cells, which show low expression, from among the ubiquitously expressing cell lines. To further investigate the regulatory role of lnc1267 expression and its relationship with IR-induced apoptosis, we determined the apoptosis rate and lnc1267 expression levels in both human cancer cell lines (HeLa and HCT116) 72 h after irradiation at doses of 0, 4, 8, and 12 Gy. Notably, as the IR dose increased, the apoptosis rate progressively rose, whereas the expression of lnc1267 gradually declined (Fig. 2A), indicating a negative correlation between the level of cell apoptosis and the expression level of lnc1267 following IR exposure.
To investigate the mechanisms underlying IR-mediated suppression of lnc1267 expression, we focused on transcriptional regulation and RNA degradation, given that steady-state RNA levels are influenced by both transcriptional rates and degradation kinetics. Considering the frequent co-regulation between lncRNAs and their host genes [26], we first predicted transcription factors binding to the promoter region of KLF7 (the host gene of lnc1267) using PROMO (http://alggen.lsi.upc.es/cgi-bin/promo_v3/ promo/promoinit.cgi? dirDB=TF_8.3). The analysis revealed that the candidate transcription factors binding to the KLF7 and lnc1267 promoter region include p53 protein (Fig. 2B), which was corroborated by JASPAR database analysis (http://jaspar.genereg.net/) showing p53 binding motifs in the KLF7 promoter (Fig. 2C). This aligns with published evidence demonstrating p53-mediated KLF7 repression through direct promoter binding [27]. Subsequently, according to previous reports indicating that p53 expression significantly increases in irradiated cells [28], we verified the relationships between the expression levels of lnc1267, its host gene KLF7, and p53 after IR treatment. As shown in Fig. 2D, with an increasing irradiation dose, the expression of p53 gradually increased, while the transcriptional levels of lnc1267 and KLF7 significantly decreased. Subsequently, we further transfected the cells using either the pcDNA3.1-p53 plasmid, which is intended for p53 overexpression, or two p53-specific small interfering RNAs (siRNAs) aimed at achieving p53 knockdown, in order to verify the effect of p53 expression on the regulation of lnc1267/KLF7.The results indicated that overexpression of p53 significantly suppressed the mRNA expression levels of both lnc1267 and KLF7, and vice versa (Fig. 2E), suggesting that lnc1267 and its host gene KLF7 are also co-transcribed through p53. In addition, knockout of p53 also completely abolished IR-mediated lnc1267 suppression (Fig. 2F), which indicates that the inhibition of lnc1267 expression by IR is dependent on p53 expression. Finally, ChIP-qPCR analysis confirmed the recruitment of p53 to KLF7 promoter region, with a marked increase in binding affinity following IR exposure (Fig. 2G). The above results suggest that p53 directly binds to the KLF7 and lnc1267 promoter and that the binding events induced by IR mediate a significant suppression of the co-transcriptional activity of KLF7 and lnc1267.
Fig. 2IR significantly inhibits lnc1267 expression in multiple cells by up-regulating p53 expression. A At 72 h post-irradiation, the expression levels of lnc1267 and cell apoptosis rate were measured using RT-qPCR and Annexin V-FITC/PI double staining assays respectively in HCT116 and HeLa that received single doses of 0, 4, 8, and 12 Gy γ rays or sham irradiation. B The transcription factors that potentially bind to the promoter region of KLF7 were predicted by PROMO software. C Sequence logo of the p53 DNA-binding motif in the KLF7 promoter region predicted by JASPAR. D After 72 h of irradiation, RT-qPCR and Western Blot techniques were employed to analyze the expression levels of p53, KLF7, and lnc1267 in HCT116 cells that had been irradiated with single doses of 0, 4, 8, and 12 Gy γ rays. E The expression levels of p53, KLF7, and lnc1267 were quantitatively determined in HCT116 cells following the upregulation and downregulation of p53 expression, using pcDNA3.1 overexpression plasmids and small interfering RNAs (siRNAs) targeting p53, respectively. F 72 h post-irradiation, the relative expression level of lnc1267 was accurately assessed by RT-qPCR in 8 Gy and sham-irradiated p53-knockout HCT116 cells (p53^−/−^ HCT116). The expression level of p53 protein was thoroughly verified through Western Blot analysis. G Binding capacities of p53 to the predicted region in the KLF7 promoter, as determined using ChIP assay. H The relative expression of lnc1267 in HCT116 Cells 48 h post-irradiation (left) and the quantification of steady-state lnc1267 levels after ActD treatment in irradiated and sham-irradiated HCT116 cells (right) were determined using RT-qPCR assays. The relative amount of lnc1267 was calculated at each time point using the formula (lnc1267_ActD_/lnc1267_DMSO_). All measurement data in the figures were expressed as mean ± standard deviation. Data were analyzed using an unpaired two-sided Student’s t-test. n = 3; *P < 0.05, **P < 0.01, ***P < 0.001
Additionally, the transcriptional inhibitor Act D was utilized to investigate the post-transcriptional regulatory mechanisms underlying the radiation-induced suppression of lnc1267 expression. As shown in Fig. 2H, the steady-state levels of lnc1267 were not significantly different between the irradiated cells and the control cells, indicating that IR does not affect the RNA stability of lnc1267.
Taken together, these findings demonstrate that IR inhibited the expression of lnc1267 at the transcriptional level by upregulating p53 rather than reducing its stability.
Downregulation of lnc1267 expression increases IR-induced cell apoptosis and radiosensitivity
The above results revealed that lnc1267 expression was negatively correlated with IR-induced cell apoptosis. For analysis of the effect of lnc1267 expression on cell apoptosis, two LNA sequences were designed and synthesized to knockdown lnc1267 in human cancer cells (HCT116 and HeLa) (Supplementary Fig. S4A, B). Using the HCT116 cells as an example, knockdown of lnc1267 by the two LNA sequences induced apoptosis rates of 48.70% ± 4.92% and 43.59% ± 4.97%, respectively, compared to the control group, which had an apoptosis rate of only 9.54% ± 1.52%. Consistent with our observations in HCT116 cells, a marked increase in apoptosis rates was observed in HeLa cells (Fig. 3A). One of the identical LNA sequences was further used to knockdown lnc1267 in mouse NIH/3T3 cells (Supplementary Fig. S9A), and similarly, lnc1267 knockdown led to a marked elevation in apoptosis rates in these cells (Supplementary Fig. S9B). These results demonstrate that lnc1267 downregulation robustly promotes apoptosis across multiple cell types (human HCT116, HeLa and mouse NIH/3T3 cells), indicating the evolutionarily conserved and critical role of lnc1267 in apoptotic regulation. To further investigate the biological role of lnc1267, we conducted both colony formation and CCK-8 assays to assess the impact of lnc1267 silencing on cell clonogenicity and proliferative capacity. The findings presented in Fig. 3B and C clearly demonstrate that downregulation of lnc1267 significantly impairs the proliferation and colony-forming abilities of both HCT116 and HeLa cells. This above observation strongly suggested that the crucial role of lnc1267 in regulating cancer cell apoptosis and proliferation.
To further investigate the impact of lnc1267 expression on cell apoptosis triggered by IR, we used CRISPR/Cas9 technology to establish stable cell lines with lnc1267 knockout in HCT116 and HeLa cells (Supplementary Fig. S4C, D). After 72 h of treatment with 8 Gy, HCT116 and HeLa cells with stable lnc1267 knockout were collected for Annexin V-FITC/PI staining to assess the percentage of apoptotic cells. Our results demonstrated that lnc1267 downregulation significantly potentiated IR-induced apoptosis in both HCT116 and HeLa cells (Fig. 3D, E). In addition, we also evaluate the functional role of the lnc1267 transcript in the cellular response to irradiation by employing lentiviral transduction to establish stable cell lines that either overexpress lnc1267 (LV-lnc1267) or contain control oligonucleotides (LV-NC). The initial experiments showed that at 0 Gy, the baseline apoptosis rates were similar between lnc1267-overexpressing cells and vector control cells. However, under γ-irradiation (8 Gy/12 Gy), overexpression of lnc1267 significantly attenuated radiation-induced apoptosis. This cytoprotective effect persisted across doses, with a consistent reduction in apoptotic cells observed at all tested radiation intensities compared to irradiated controls (Supplementary Fig. S4E). To investigate whether the mouse lnc1267 homolog shares similar functional properties, we analysed the apoptosis and colony formation efficiency of irradiated NIH/3T3 cells following overexpression of the mouse lnc1267 sequence (LV-m-lnc1267). Consistent with our findings in human cells, a significant decrease in apoptotic cells and a significant increase in radioresistance (Survival Enhancement Ratio, SER = 0.435) were observed in NIH/3T3 cells overexpressing mouse lnc1267 (Supplementary Fig. S9C–E). These results indicate that lnc1267 exhibits functional conservation in regulating IR-induced apoptosis and radiosensitivity between mouse and human cells.
Fig. 3. Downregulation of lnc1267 expression significantly enhances cell apoptosis in multiple cell lines. A After 48 h of knockdown of lnc1267 using LNAs, the expression levels of lnc1267 and cell apoptosis rates were precisely determined in HCT116 and HeLa cells through RT-qPCR and Annexin V-FITC/PI double staining assays, respectively. B CCK-8 assay was performed to examine cell activity following the silencing of lnc1267. C Colony formation assay was conducted to calculate the colony formation rate of HCT116 and HeLa cells following the silencing of lnc1267. D and E After 72 h of irradiation, Annexin V-FITC/PI double staining assay was used to examine apoptosis rates in HCT116 and HeLa cells, including lnc1267-knockout (KO ^(−/−)^) and wild-type controls (WT ^(+/+)^), each exposed to 0 or 8 Gy. F and G Colony formation assay was performed to determine the survival fractions of HCT116 and HeLa cells with lnc1267-knockout (KO ^(−/−)^) or wild-type controls (WT ^(+/+)^) after exposure to graded radiation doses (0, 1, 2, 4, and 8 Gy) ; The survival fraction curve was plotted using the single-hit multitarget model (SF = 1–[1–e^–D/D0^] ^N^). SER = Dq(lnc1267 WT ^(+/+)^)/Dq(lnc1267 KO ^(−/−)^). All measurement data in the figures were expressed as mean ± standard deviation. A multi-way classification analysis of variance test was conducted to evaluate the data obtained from the CCK8 assays. For the other data, an unpaired two-tailed Student’s t-test was used for analysis. n = 3; *P < 0.05, **P < 0.01, ***P < 0.001
Additionally, the radiosensitivity of HCT116 and HeLa cells following the knockout of lnc1267 was also evaluated using a clonogenic survival assay. Both lnc1267 knockout and control cells were exposed to varying doses of IR (0, 1, 2, 4, or 8 Gy), and cell survival was monitored two weeks post-treatment. The findings revealed a marked reduction in the survival of the lnc1267 knockout cells compared to the control cells (lnc1267 WT ^(+/+)^). The sensitizing enhancement ratio (SER) was calculated using a single-hit multitarget model based on clonogenic survival assays. The results demonstrated that lnc1267 knockdown significantly enhanced tumor cell radiosensitivity, with SER values of 2.088 and 2.120 in HCT116 cells, and 2.336 and 3.128 in HeLa cells, respectively (Fig. 3F and G).
Collectively, these data unequivocally demonstrate that lnc1267 downregulation significantly enhances apoptosis and radiosensitivity in cancer cells.
Lnc1267 downregulation promotes NF-κB-mediated apoptosis via p65-Ser536 phosphorylation in a p53-independent manner
To elucidate the intricate apoptotic mechanism mediated by lnc1267, we performed RNA-seq to identify genes affected by lnc1267 knockdown. Our results demonstrated that lnc1267 knockdown in HCT116 cells resulted in upregulation of 989 genes and downregulation of 903, while in HeLa cells, 873 genes were upregulated and 556 were downregulated (adjusted p value < 0.05; |log_2_foldchange|≥1) (Supplementary Fig. S5A). A heatmap was generated to visualize these differentially expressed genes in both HCT116 and HeLa cells following lnc1267 knockdown, in contrast to the results in the sham-irradiation group (Supplementary Fig. S5B). Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis further revealed that the p53 signalling pathway and NF-κB signalling pathway were the most notable apoptosis-related pathways enriched in the differentially expressed genes identified from the transcriptome sequencing data of both HeLa and HCT116 cells (Fig. 4A, B). Additionally, our results further demonstrated a significant increase in p53 protein expression and RelA/p65 phosphorylation at Ser536 in both HeLa and HCT116 cells upon lnc1267 knockdown (Fig. 4C, D). Investigations into common pro-apoptotic and anti-apoptotic genes downstream of both signaling pathways revealed a dramatic upregulation of pro-apoptotic PUMA coupled with significant downregulation of anti-apoptotic Bcl-2, providing compelling evidence for concurrent activation of both p53 and NF-κB signaling pathways (Fig. 4C, D).
Fig. 4. Downregulation of lnc1267 induces cell apoptosis primarily mediated by activation of RelA/p65 Ser536 phosphorylation. A and B KEGG pathway enrichment analysis was conducted for differential genes (fold change ≥ 2 compared to control) obtained from RNA-seq data following lnc1267 knockdown in HeLa and HCT116 cells. C and D Western Blotting and RT-qPCR assays were used to detect the mRNA and protein expression levels of p65, p53, and their downstream apoptosis-related genes following lnc1267 knockdown in HeLa and HCT116 cells. E HeLa cells were sequentially transfected with si-p53 for 12 h and then LNA-lnc1267. Samples were collected 48 h post second transfection. Annexin V-FITC/PI double staining assays were conducted to assess apoptosis in p53-silenced HeLa cells following lnc1267 knockdown. Western Blot analysis was also conducted to detect the p53 expression and the phosphorylation levels of RelA/p65 at Ser536. F HeLa cells were pretreated with QNZ (an inhibitor of RelA/p65 Ser536 phosphorylation) for 2 h, transfected with LNA-lnc1267, and harvested 24 h later for Annexin V-FITC/PI staining to assess apoptosis. Western Blot analysis was also conducted to detect the p53 expression and the phosphorylation levels of RelA/p65 at Ser536. G 72 h after irradiation with doses of 0 and 8 Gy, Annexin V-FITC/PI double staining assays were conducted to investigate apoptosis in lnc1267 knockout HeLa cells pretreated with QNZ. Western Blot analysis was also conducted to detect the phosphorylation levels of RelA/p65 at Ser536. All measurement data presented in the figures are expressed as mean ± standard deviation. Statistical analysis was performed using an unpaired two-sided Student’s t-test. n = 3; *P < 0.05, **P < 0.01, ***P < 0.001
To further elucidate the mechanisms underlying lnc1267-mediated regulation of apoptosis, we assessed apoptotic activity following lnc1267 knockdown in both p53-knockdown HCT116/HeLa cells. Our results demonstrated that lnc1267 downregulation significantly induced apoptosis in p53-knockdown HeLa cells, while RelA/p65 phosphorylation at Ser536 remained unaffected (Fig. 4E). Consistent with observations in HCT116 cells, p53 knockdown failed to block either the apoptosis-promoting effect or the activation of RelA/p65 phosphorylation at Ser536 induced by lnc1267 downregulation (Supplementary Fig. S6A). The above findings demonstrate that the cell apoptosis induced by lnc1267 downregulation occurs independently of the p53 pathway and may be mediated by the NF-κB signaling pathway.
To verify NF-κB-dependency of lnc1267 downregulation-induced apoptosis, rescue experiments were performed in HeLa and HCT116 cells with or without IR-induced apoptosis. Pretreatment with QNZ (an inhibitor of NF-κB signaling pathway via the inhibition of RelA/p65 phosphorylation at Ser536) suppressed the activation of the NF - κB pro-apoptotic process [29]. The results demonstrated that pretreatment with QNZ inhibited RelA/p65 phosphorylation at Ser536 and simultaneously abolished the apoptosis induced by lnc1267 downregulation in HeLa cells (Fig. 4F). Similar to findings in HCT116 cells, QNZ pretreatment suppressed both RelA/p65 phosphorylation at Ser536 activation and the pro-apoptotic effects caused by lnc1267 downregulation (Supplementary Fig. S6B). For further analysis of the molecular mechanism by which lnc1267 regulates IR-induced apoptosis, HCT116 and HeLa cells with stable knockout of lnc1267 were pretreated with QNZ and subsequently irradiated with 8 Gy. In HeLa cells, the absence of lnc1267 significantly enhanced 8 Gy radiation-induced apoptosis, accompanied by increased phosphorylation of RelA/p65 at Ser536; QNZ pretreatment effectively alleviated this pro-apoptotic effect by specifically inhibiting p65-Ser536 phosphorylation (Fig. 4G). Similarly, in the HCT116 cell model, lnc1267 knockout exacerbated IR-induced apoptosis and promoted RelA/p65-Ser536 phosphorylation, whereas QNZ treatment showed significant inhibitory effects on these responses (Supplementary Fig. S6C). Taken together, our data showed that lnc1267 knockdown markedly enhances IR-induced apoptosis via NF-κB activation through p65-Ser536 phosphorylation, independently of p53.
Lnc1267 interacts with HnRNP U through its core functional sequence FL2 (Δ2:4785–7531 nt)
It has been established that lnc1267 regulates cell apoptosis through mediation by the NF-κB signaling pathway. To clarify the molecular mechanism by which lnc1267 downregulation enhances p65 phosphorylation at Ser536, we detected the upstream kinases (RSK1, TBK1, IKKβ) regulating p65 Ser536 phosphorylation and their phosphorylated forms (p-P90RSK Ser380, p-TBK1 Ser172, p-IKKα/β Ser176/180). Compared with the LNA-NC group, lnc1267 knockdown caused no significant changes in the total protein levels of these three kinases, but only markedly upregulated p-TBK1 Ser172 (Supplementary Fig. S10A). We further validated the mediating role of p-TBK1(Ser172) in lnc1267 downregulation-induced p65 Ser536 phosphorylation and cell apoptosis using its specific inhibitor GSK8612. Results showed that GSK8612 significantly inhibited lnc1267 knockdown-induced p-TBK1(Ser172) upregulation, but not p65 Ser536 phosphorylation (Supplementary Fig. S10B); meanwhile, p-TBK1(Ser172) inhibition failed to attenuate lnc1267 downregulation-triggered cell apoptosis compared with the control group (Supplementary Fig. S10C). These findings suggest that lnc1267-mediated activation of p-p65(Ser536) is independent of the above upstream kinases.
Since lncRNAs typically function through forming ribonucleoprotein complexes, to further elucidate the precise mechanism by which lnc1267 regulates the NF-κB signaling pathway, we need to identify the lnc1267-interacting proteins involved in this regulation. As previous studies have demonstrated that lncRNAs regulate cellular functions through binding events that critically depend on their secondary structures [30]. To delineate the core functionality of lnc1267, a segmented overexpression strategy was implemented based on its secondary structure predicted by the RNAfold web server (Fig. 5A). Notably, overexpression of the FL2 domain (Δ2:4785-7531nt) significantly attenuated IR-induced cell apoptosis, recapitulating full-length lnc1267’s anti-apoptotic effect, whereas the FL1 domain (Δ1:1-4784nt) exhibited no protection against IR-induced apoptosis (Fig. 5B), suggesting FL2 is the critical functional domain for lnc1267’s anti-apoptotic regulation. Additionally, to further validate the domain-specific functionality, we implemented a reciprocal rescue strategy in which: (i) FL1-overexpressing cells were treated with LNA-lnc1267-2 (targeting FL2 while preserving FL1); (ii) FL2 - overexpressing cells were treated with LNA-lnc1267-1 (targeting FL1 while preserving FL2). Quantitative analysis revealed that FL2 overexpression completely reversed the pro-apoptotic effects of lnc1267 knockdown compared with knockdown controls, whereas FL1 overexpression showed no significant rescue effect compared with knockdown controls (Fig. 5C). The results definitively establish FL2 as the indispensable functional domain for apoptosis regulation.
Fig. 5. Lnc1267 interacts with hnRNP U through its core functional sequence FL2 (Δ2:4785–7531 nt). A The secondary structure of lnc1267 was predicted using the RNAfold web server (http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi). B The apoptosis rates of HeLa cells stably overexpressing two truncated regions of human lnc1267, specifically F1 (Δ1: 1–4784 nt) and F2 (Δ2: 4785–7531 nt), were examined 72 h after irradiation (0 or 12 Gy). C Apoptosis rates were assessed 48 h after lnc1267 knockdown in HeLa cells stably overexpressing FL1 or FL2. D Silver staining was performed to detect biotinylated FL2 fragment-associated proteins following RNA pull-down assays. The FL2 and lacZ control RNA were biotinylated through in vitro transcription, refolded, and subsequently incubated with HeLa nuclear cell lysates. Two lnc1267-specific bands (red frame) were excised and analyzed by mass spectrometry, which identified hnRNP U. E Computational analysis was conducted to explore the interaction propensities of the full-length lnc1267/FL2 fragment and their binding proteome using catRAPID. F Western Blot was performed to detect hnRNP U from lacZ and FL2 pull-down assays. G RIP for lnc1267 and hnRNP U. HeLa cell lysates were immunoprecipitated with control mouse IgG or anti-hnRNP U antibody, and the complexes were analyzed for the presence of lnc1267 or GAPDH by RT-qPCR, GAPDH was used as a negative control. Specific immunoprecipitation of hnRNP U was confirmed by Western Blot. All measurement data presented in the figures are expressed as mean ± standard deviation. Statistical analysis was performed using an unpaired two-sided Student’s t-test. n = 3; *P < 0.05, **P < 0.01, ***P < 0.001
To screen for the interacting proteins of lnc1267, we first characterized its subcellular localization as a prerequisite for interactome screening. Combined fluorescence in situ hybridization (FISH) and nucleocytoplasmic fractionation assays consistently demonstrated that lnc1267 is exclusively localized in the nucleus (Supplementary Fig. S7A and B). Based on this finding and our previous identification of FL2 as the functional core domain, nuclear extracts from HeLa cells were subjected to RNA pull-down assays using biotinylated FL2 RNA, followed by silver staining and Western Blotting. The results showed that the targeted probe demonstrated specific protein extraction capability from HeLa nuclear lysates compared to the LacZ control probe. Protein binding profiles revealed predominant signals at ~ 120 kDa and 42 kDa (Fig. 5D). After excising and pooling these two bands from the same lane, mass spectrometry analysis identified six consistently detected proteins. Notably, hnRNP U exhibited molecular weights matching the silver-stained bands (Fig. 5D), suggesting its potential involvement in the lnc1267-protein complex. This inference was further supported by predictions of lnc1267-hnRNPU interactions from the CatRAPID database (http://service.tartaglialab.com/email_redir/916967/0e6043bd95) (Fig. 5E). To validate this interaction, we performed RNA pull-down assays followed by Western blot analysis, which confirmed the binding between hnRNPU and lnc1267 (Fig. 5F). Additionally, RNA immunoprecipitation (RIP) assays revealed specific enrichment of hnRNP U by lnc1267, further indicating a strong interaction between them (Fig. 5G). These above results confirm that lnc1267 is a binding partner of hnRNP U. Previous studies have demonstrated that UV irradiation activates hnRNP U, which interacts with IKKβ to trigger the NF-κB pathway and induce apoptosis [31]. Taken together, our findings suggest that lnc1267 may act as a negative regulator of hnRNP U, as its downregulation likely releases hnRNP U to activate NF-κB-dependent apoptosis.
Lnc1267 competitively binds HnRNP U to attenuate IR-Induced NF-κB activation and apoptosis by disrupting IKKβ interaction
The aforementioned results confirm a strong binding interaction between hnRNP U and lnc1267. To functionally characterize the role of hnRNP U in NF - κB signaling activation and apoptosis following lnc1267 downregulation, we performed siRNA-mediated knockdown of hnRNP U. Strikingly, silencing hnRNP U not only significantly decreased the phosphorylation level of RelA/p65 at Ser536 and the basal rate of cellular apoptosis (Supplementary Fig. S8A, B), but also completely reversed both the apoptotic response and the phosphorylation status induced by lnc1267 downregulation (Fig. 6A). Additionally, we found that hnRNP U knockdown also reversed the increased RelA/p65 phosphorylation at Ser536 and cell apoptosis induced by 8 Gy irradiation resulting from lnc1267 deficiency (Fig. 6B). These data demonstrate that the pro-apoptotic effects of lnc1267 downregulation are mediated through its interaction with hnRNP U, thereby compromising the regulatory capacity of hnRNP U in the NF-κB signaling pathway.
Fig. 6hnRNP U mediates the resistance effect of lnc1267 against IR-induced cell apoptosis through its interaction with IKKβ. A HeLa cells were transfected with hnRNP U siRNA for 12 h, followed by transfection with LNA-lnc1267. Samples were collected 48 h post second transfection, and apoptosis rates were determined using Annexin V-FITC/PI staining to quantify lnc1267 knockdown-induced apoptosis following hnRNP U downregulation. B After hnRNP U knockdown, lnc1267-knockout HeLa cells were irradiated (8 Gy), and apoptosis was assessed 48 h post-irradiation using Annexin V-FITC/PI staining. C Western Blot was performed to evaluate the effects of lnc1267 downregulation on the expression levels of phosphorylated RelA/p65 (Ser536) and IκBα, as well as its influence on the 8 Gy irradiation-induced upregulation of phosphorylated RelA/p65 (Ser536) and suppression of IκBα. D Overexpression of the lnc1267-FL2 fragment interfered with ionizing radiation-induced association of hnRNP-U with IKKβ. The association of these proteins was analyzed by immunoprecipitation assay. E Knockout of the lnc1267 promoted ionizing radiation-induced association of hnRNP U with IKKβ. F A theoretical model of lnc1267-mediated IR-induced NF-κB activation leading to cell apoptosis. The suppression of lnc1267 expression by IR leads to the association of endogenous hnRNP U with IKKβ, which in turn activates the upregulation of NF-κB-mediated pro-apoptotic gene expression. The association between hnRNP U and IKKβ was analyzed by immunoprecipitation assay. All measurement data presented in the figures are expressed as mean ± standard deviation. Statistical analysis was performed using an unpaired two-sided Student’s t-test. n = 3; *P < 0.05, **P < 0.01, ***P < 0.001
To further consolidate the central role of the lnc1267-hnRNP U interaction in modulating IR-induced NF-κB signaling pathway activation and cellular apoptosis, we referenced prior research demonstrating that UV irradiation enhances the binding of hnRNP U to IKKβ, leading to IκBα degradation, NF-κB signaling pathway activation, and the induction of cell apoptosis [31]. In our study, the downregulation of lnc1267 indeed led to decreased IκBα expression, thereby activating the NF-κB signaling pathway. Moreover, its downregulation also facilitated the IR-induced decrease in IκBα expression and activation of the NF-κB signaling pathway (Fig. 6C). This suggests that lnc1267 might regulate the NF-κB signaling pathway and radiation-induced cell apoptosis by modulating the interaction between hnRNP U and IKKβ. Co-immunoprecipitation (co-IP) assays revealed a robust enhancement of the hnRNP U-IKKβ interaction upon radiation exposure. Strikingly, lnc1267 overexpression suppressed this interaction, whereas lnc1267 knockdown further amplified it (Fig. 6D, E). Combined with our earlier observations that lnc1267 downregulation promotes radiation-induced apoptosis and activation of the NF-κB signaling pathway, while its overexpression confers resistance, these findings collectively establish a competitive binding mechanism. In this mechanism, lnc1267 sequesters hnRNP U to block its interaction with IKKβ. Loss of lnc1267 liberates hnRNP U to bind IKKβ, enhancing IκBα degradation and sustaining NF-κB activation, thereby amplifying IR-induced apoptosis (Fig. 6F).
Discussion
The efficacy of radiotherapy in cancer treatment is significantly limited by tumor radioresistance, where dysregulation of apoptotic signaling networks plays a central role [32]. NF-κB, a pivotal regulator of tumor radioresistance, mediates dual roles in anti-apoptotic and pro-apoptotic pathways [4]; however, the molecular mechanisms underlying its pro-apoptotic function in radiation response remain poorly understood. LncRNAs have emerged as critical modulators of apoptotic pathways, including NF-κB signaling pathway [33], yet the functions and mechanisms of these lncRNAs—particularly evolutionarily conserved ones—in IR-induced apoptosis remain unclear. In this study, we identified and characterized a novel human/mouse homologous lncRNA (lnc1267) for the first time. Functional analyses revealed that its downregulation led to the enhancement of IR-induced cancer cell apoptosis and radiosensitivity by activating the NF-κB pro-apoptotic pathway. Crucially, we demonstrated that IR transcriptionally suppresses lnc1267 expression via p53 upregulation. This suppression subsequently promotes the interaction between hnRNP U and IKKβ, leading to RelA/p65 phosphorylation at Ser536 and ultimately triggering apoptosis. The comprehensive “p53–lnc1267–hnRNP U/IKKβ” axis under IR stress provides novel mechanistic insights into NF-κB pro-apoptosis and identifies potential therapeutic targets.
LncRNAs have emerged as important regulators in various physiological processes and diseases, including development and tumorigenesis. Despite their significance, the functions of most lncRNAs remain unknown due to their extremely low sequence conservation [19]. Conserved lncRNAs may be more important as they have survived under evolutionary selective pressure [34]. The biological phenotypes of conserved lncRNAs highlight their cross-species importance, and studying multi-species conserved lncRNAs contributes to a comprehensive understanding of disease pathogenesis. For example, mice with the conserved lncRNA EPR knocked out exhibit higher susceptibility to colitis and tumor formation when induced with dextran sulfate sodium [35]. Zebrafish with knockout of the transgenic conserved lncRNA THOR show fertilization failure and resistance to melanoma development [36]. Although several studies have demonstrated that lncRNAs can function as promising radiosensitization targets in cancer therapy, their limited evolutionary conservation poses significant challenges for cross-species research and preclinical validation [16]. Sequence analysis to identify homologous lncRNAs and verify their radiosensitivity regulatory functions could help screen conserved targets with clinical translation potential—a critical strategy to address this challenge [21]. Through sequence and structural characterization, we identified lnc1267 as a novel, evolutionarily conserved lncRNA exhibiting 80.43% homology between humans and mice, with a 3′ polyA tail and absence of a 5′ cap structure. Importantly, we demonstrate for the first time its critical role in regulating IR-induced apoptosis and cancer cell radiosensitivity. Additionally, our study reveals that IR induces the suppression of lnc1267 through p53-mediated promoter binding, rather than modulating its RNA stability. This represents the first lncRNA identified to be transcriptionally regulated by p53 under IR stress, expanding the understanding of p53’s regulatory network in radiation response. These findings establish a theoretical foundation for developing novel radiosensitization strategies. Specifically, p53-activating agents targeting the p53-lnc1267 axis may selectively enhance cancer cell apoptosis upon irradiation and offer a promising approach to overcome clinical radioresistance in the future. Notably, the evolutionary conservation of lnc1267 across humans and mice further underscores its potential as a translatable target, laying the groundwork for the development of lnc1267-based targeted intervention strategies in clinical radiotherapy. Future research should prioritize preclinical validation of lnc1267 inhibitors in patient-derived xenograft models of radioresistant tumors, as well as the exploration of combinatorial strategies combining lnc1267 targeting with conventional radiotherapy to optimize therapeutic efficacy and minimize normal tissue toxicity.
As a master regulator of cellular stress responses, NF-κB exhibits functional duality—pro-survival or pro-apoptotic effects—that is critically determinant in radiotherapy outcomes. Typically, NF-κB is widely regarded as a key tumorigenic factor due to its strong anti-apoptotic and pro-proliferative effects in cancer cells. Numerous studies have confirmed that inhibiting its activity can enhance the sensitivity of cancer cells to apoptosis induced by radiotherapy and chemotherapy [6]. For instance, in nasopharyngeal and breast cancer models, the abnormal activation of NF-κB resists radiation-induced cell apoptosis, significantly enhancing the radioresistance of tumor cells [37, 38]. Recent studies have revealed that NF-κB regulates apoptosis sensitivity through phosphorylation of the RelA/p65 Ser536 site. For example, Bu et al. demonstrated that activating NF-κB RelA/p65 Ser536 phosphorylation promotes RITA-induced apoptosis in breast cancer, colorectal cancer, and other tumor cells [8]. Nevertheless, the pro-apoptotic effects and molecular mechanism by which IR regulates RelA/p65 Ser536 phosphorylation remain unclear. Our study has demonstrated that downregulation of a novel lncRNA lnc1267, which activates the NF-κB pathway, also plays a significant role in promoting cellular sensitivity to IR-induced apoptosis. This pro-apoptotic property is dynamically regulated by phosphorylation of the RelA/p65 Ser536 site. Although there is no direct evidence that lncRNAs regulate RelA/p65 Ser536 phosphorylation to induce apoptosis in response to IR, this finding aligns with previous research. For example, Shao et al. showed that lncRNA-Airn can inhibit CCl₄- and H₂O₂-induced hepatocyte apoptosis by suppressing RelA/p65 Ser536 phosphorylation, thereby alleviating acute liver injury [39]. Tian et al. discovered that knocking down lncRNA NR_120420 reduces oxygen-glucose deprivation-induced apoptosis in SH-SY5Y cells by decreasing RelA/p65 Ser536 phosphorylation levels [40]. Additionally, it is worth noting that previous studies have confirmed that UV irradiation modulates the interaction between hnRNP U and IKKβ, thereby regulating RelA/p65 Ser536 phosphorylation and inducing the NF-κB pro-apoptotic signaling cascade [31]. However, whether IR affects the hnRNP U-IKKβ interaction and the molecular mechanism underlying IR-mediated regulation of their binding remains unclear. Our study reveals that IR suppresses lnc1267 expression, and this downregulation enhances hnRNP U-IKKβ interaction. Conversely, lnc1267 overexpression inhibits IR-induced hnRNP U-IKKβ binding. These findings fill this knowledge gap by uncovering a novel lncRNA-mediated mechanism through which the NF-κB pathway regulates radiation-induced apoptosis.
The crosstalk between NF-κB and p53 signaling pathways plays a pivotal role in regulating cellular apoptotic responses. For instance, lncRNA 00607 binds to the promoter region of RelA/p65 to repress its transcription, thereby elevating intracellular p53 protein levels and ultimately exerting anti-proliferative and pro-apoptotic effects both in vitro and in vivo [41]. Another lncRNA, LOC285194, induces p53 expression upon 1-hydroxy-1-norresistomycin treatment, which suppresses NF-κB expression and exerts anti-tumor effects by inhibiting proliferation and promoting intrinsic apoptosis in non-small cell lung cancer cells [42]. Given the central role of NF-κB/p53 crosstalk in apoptotic regulation, clarifying the interplay between apoptosis-associated lncRNAs and the NF-κB/p53 pathway is expected to provide a more precise therapeutic basis for optimizing radiation protection strategies and enhancing the efficacy of radiotherapy. In the present study, we further identified that IR triggers a feedback regulatory loop involving p53-lnc1267-NF-κB. Specifically, IR activates p53, which transcriptionally represses lnc1267. The downregulation of lnc1267 then induces RelA/p65 phosphorylation and subsequent activation of the NF-κB pathway, leading to the promotion of cellular apoptosis. Furthermore, the NF-κB-mediated apoptotic signal can conversely facilitate p53 expression, thereby forming a closed feedback regulatory loop. The core value of this loop lies in maintaining the homeostasis of cellular fate in response to radiation: by precisely regulating the activation levels of the p53 and NF-κB pathways, it effectively circumvents radioresistance in tumor cells arising from abnormal activation of these pathways, while endowing cells with a dose-specific responsiveness to radiation. Distinct from the unidirectional p53-NF-κB interaction models reported previously, this loop achieves bidirectional regulation with lnc1267 as the core node, and crucially, its activation is strictly dependent on radiation stimulation. These findings enrich our understanding of the context-specificity of lncRNA-mediated pathway crosstalk and further provide potential therapeutic targets for optimizing tumor radiotherapy.
In summary, this study identifies lnc1267 as the first conserved lncRNA that critically regulates IR-induced apoptosis and radioresistance. We comprehensively characterized a novel ‘p53–lnc1267–hnRNP U/IKKβ–NF-κB’ pro-apoptotic signaling axis in the radiation response, providing mechanistic insights into radiation-induced cell death. Importantly, targeted downregulation of lnc1267 significantly enhances both IR-induced apoptosis and radiosensitivity in multiple cancer cell types, highlighting its translational potential as a therapeutic target for radiosensitization. Notwithstanding these strengths, the study has inherent limitations: our analyses were primarily conducted in in vitro cell models, with limited validation in preclinical mouse models. Future research should therefore prioritize developing highly specific lnc1267-targeted agents, evaluating their efficacy and safety in patient-derived xenograft models and early-phase clinical trials, and optimizing combinatorial radiotherapy strategies to balance therapeutic efficacy and normal tissue toxicity.
Supplementary Information
Below is the link to the electronic supplementary material.
Supplementary file 1 (PDF 252 KB)
Supplementary file 2 (DOCX 8.12 MB)
Supplementary file 3 (PDF 2.10 MB)