The Link Between VDR Gene rs7975232 Polymorphism and Benign Proliferative Breast Disease in Ukrainian Population
Olha Obukhova, Mykola Kyrychenko, Ivan Lukavenko, Viktoriia Yu. Harbuzova

TL;DR
This study explores how a specific VDR gene variant is linked to benign breast disease in the Ukrainian population.
Contribution
The study identifies a potential genetic marker for benign proliferative breast disease in a specific population.
Findings
The rs7975232 polymorphism shows a significant association with BPBD risk in individuals aged 40 and above.
Heterozygotes have a lower BPBD risk compared to homozygotes in older individuals after adjusting for BMI.
Recessive allele homozygotes have a higher BPBD risk compared to major allele carriers after BMI adjustment.
Abstract
We are aimed at examining the potential link between the VDR gene polymorphism rs7975232 and the occurrence of benign breast disease in the Ukrainian population. One hundred and six patients with BBD and 221 control subjects were enrolled in this case‐control study. PCR‐RFLP was used for VDR gene rs7975232 genotyping. SPSS software package (Version 25.0, IBM, USA) was used for data analysis. There was a research relationship between the rs7975232 polymorphism and BPBD and other influencing factors as family history burden, predisposing factors, and blood estradiol levels, smoking, gynecological pathology, hormone intake, goiter, or mastodynia. In individuals younger than 40, heterozygotes have a higher BPBD risk compared with both homozygotes (p = 0.04), but this risk is not statistically significant after adjusting for BMI (p = 0.16). Conversely, for those aged 40 and above,…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1| Group |
| Genotype |
| ||
|---|---|---|---|---|---|
| a/a (%) | a/А (%) | A/A (%) | |||
|
| |||||
| Control | 106 | 34 (32.1) | 48 (45.3) | 24 (22.6) | 0.868 (0.282) |
| Case | 221 | 67 (30.3) | 107 (48.4) | 47 (21.3) | |
| Model |
| ORobs (95% CI) |
| OR
|
|---|---|---|---|---|
|
| ||||
| Dominant | 0.747 | 1.085 (0.659–1.787) | 0.918 | 1.028 (0.605–1.748) |
| Recessive | 0.778 | 0.923 (0.529–1.612) | 0.584 | 1.184 (0.647–2.164) |
| Over dominant | 0.595 | 1.134 (0.713–1.805) | 0.715 | 0.911 (0.553–1.502) |
| Additivea | 0.652 | 1.131 (0.663–1.932) | 0.802 | 0.928 (0.52–1.658) |
| 0.985 | 0.994 (0.523–1.888) | 0.753 | 1.116 (0.562–2.216) | |
| Model |
| ORobs(95%CI) |
| OR
|
|---|---|---|---|---|
|
| ||||
| Dominant | 0.524 | 1.227 (0.653–2.305) | 0.665 | 1.165 (0.585–2.32) |
| Recessive | 0.066 | 0.522 (0.261–1.044) | 0.211 | 0.611 (0.283–1.321) |
| Over dominant | 0.040 | 1.858 (1.029–3.357) | 0.160 | 1.588 (0.833–3.025) |
| Additivea | 0.181 | 1.596 (0.805–3.165) | 0.352 | 1.421 (0.678–2.975) |
| 0.372 | 0.694 (0.312–1.547) | 0.537 | 0.759 (0.316–1.824) | |
|
| ||||
| Dominant | 0.694 | 0.847 (0.372–1.931) | 0.565 | 0.779 (0.333–1.825) |
| Recessive | 0.057 | 2.652 (0.971–7.245) | 0.033 | 3.119 (1.097–8.868) |
| Overdominant | 0.036 | 0.424 (0.19–0.943) | 0.012 | 0.342 (0.147–0.794) |
| Additivea | 0.185 | 0.545 (0.222–1.227) | 0.095 | 0.446 (0.173–1.152) |
| 0.261 | 1.907 (0.619–5.869) | 0.215 | 2.125 (0.645–7.001) | |
| Genotype | ||||
|---|---|---|---|---|
| а/а ( | а/А ( | А/А ( |
| |
| Disease duration, years | 3.8 ± 2.9 | 3.2 ± 2.9 | 3.1 ± 2.8 | 0.438 |
| Age at menarche onset, years | 13.1 ± 1.3 | 13.3 ± 1.5 | 13.4 ± 1.5 | 0.572 |
| Cycle length, daysa | 25.9 ± 6.9 | 27.8 ± 3.9 | 24.8 ± 8.8 | 0.017 |
| Duration of menses, days | 5.1 ± 3.2 | 4.8 ± 1.5 | 4.6 ± 1.9 | 0.352 |
| Genotype | ||||
|---|---|---|---|---|
| а/а, | а/А, | А/А, |
| |
|
| ||||
| Not burdened | 45 (67.2) | 86 (80.4) | 26 (55.3) | 0,005 (10.667) |
| Burdened | 22 (32.8) | 21 (19.6) | 21 (44.7) | |
|
| ||||
| Present | 24 (36.9) | 34 (34.7) | 27 (61.4) | 0.008 (9.596) |
| Absent | 41 (63.1) | 64 (65.3) | 17 (38.6) | |
|
| ||||
| Nonsmoker | 47 (70.1) | 78 (72.9) | 35 (74.5) | 0.868 (0.284) |
| Smoker | 20 (29.9) | 29 (27.1) | 12 (25.5) | |
|
| ||||
| Absent | 32 (47.8) | 50 (46.7) | 20 (42.6) | 0.848 (0.329) |
| Present | 35 (52.2) | 57 (53.3) | 27 (57.4) | |
|
| ||||
| Not taking | 54 (80.6) | 83 (79) | 32 (69.6) | 0.337 (2.175) |
| Taking | 13 (19.4) | 22 (21) | 14 (30.4) | |
|
| ||||
| Absent | 54 (80.6) | 95 (88.8) | 40 (85.1) | 0.326 (2.239) |
| Present | 13 (19.4) | 12 (11.2) | 7 (14.9) | |
|
| ||||
| Absent | 26 (39.4) | 50 (46.7) | 22 (46.8) | 0.603 (1.013) |
| Present | 40 (60.6) | 57 (53.3) | 25 (53.2) | |
|
| ||||
| Not increased | 51 (79.7) | 96 (93.2) | 44 (97.8) | 0.003 (11.859) |
| Increased | 13 (20.3) | 7 (6.8) | 1 (2.2) | |
- —Ministry of Education and Science of Ukraine10.13039/501100007684
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsBreast Cancer Treatment Studies · BRCA gene mutations in cancer · Glutathione Transferases and Polymorphisms
1. Introduction
Benign breast disease (BBD) is prevalent among women and significantly affects their quality of life. The frequency of BBD in the general population is 35%–50%, and among women of reproductive age, it is 67%–95%. Certain histological types of BBD also elevate the risk of developing breast cancer. As awareness about breast cancer grows, more women are presenting at hospitals with breast lumps, many of which are benign in nature. BBDs encompass a diverse array of conditions, ranging from developmental abnormalities and inflammatory lesions to epithelial and stromal proliferation, as well as neoplasms. The main etiological factor that triggers changes in the breast is considered to be an imbalance of estrogens. Under the influence of steroid hormones, proliferative activity of glandular epithelial cells occurs. [1–3].
One of the modern methods for diagnosing benign proliferative breast disease (BPBD), involves identifying genetic markers of this condition. Promising in this context are polymorphic variants of the vitamin D receptor (VDR) gene—a nuclear receptor that, along with estrogen, progesterone, and androgen receptors, is part of the nuclear family of transcription regulators for steroid hormones [4]. Vitamin D exerts pleiotropic effects on various tissues, including cancerous tumors. Its inhibition of breast cancer growth occurs through the activation of the VDR and classical nuclear signaling pathways. Presently, besides the traditional role of vitamin D in regulating calcium levels in the body, there are also acknowledged nontraditional effects: anti‐inflammatory, antiproliferative, and proapoptotic. Research has shown that VDR controls the expression of around 200 genes affecting cell differentiation, proliferation, and apoptosis. [5–7]. Several research studies have demonstrated that 1,25(OH) and similar compounds decelerate the proliferation of tumor cells, particularly during the G0/G1 phase of the cell cycle through apoptosis induction. Moreover, 1,25(OH) suppresses angiogenesis, cellular adhesion, and migration, consequently diminishing tumor cell proliferation. [8, 9]. Currently, over 25,000 polymorphisms of the VDR gene have been studied, and some of them, including rs7975232, are associated with the development of both benign and malignant tumors in various populations worldwide [10–13].
Regarding the Ukrainian population, the results concerning the impact of the rs7975232 polymorphism on the development of BPBD are contradictory and inconclusive. Information regarding its association with proliferative benign breast dysplasia is lacking. Therefore, we have initiated our own study aimed at investigating the role of the rs7975232 polymorphism of the VDR gene in the development of premenstrual dysphoric disorder in patients from the Sumy region of Ukraine. It is important to note that understanding the influence of VDR polymorphisms will contribute to a deeper understanding of the issue of benign tumor processes in the breast, which will facilitate the development of advanced methods for early diagnosis and prognosis of these diseases.
2. The Aim
The aim of the present work was to test the possible association between VDR gene rs7975232 polymorphic variant and the development of BPBD in female patients from the Sumy region of Ukraine.
3. Materials and Methods
3.1. Study Population
A total of 327 women residing in the Sumy region of Ukraine participated in this study, including 221 patients diagnosed with BPBD (the main group) and 106 women without BPBD (the control group). The median age of the BPBD group was 33.0 years (26.0–41.0), whereas the control group was slightly higher at 36.0 years (27.5–44.0). However, there was no statistically significant difference in age between the groups (p = 0.058). Patients were selected based on characteristics commonly considered indications for genetic testing for breast cancer [14], including multiple primary tumors in a single organ or in different organs, bilateral tumors in paired organs, multifocality within one organ, early tumor onset (before 21 years of age), and family history criteria such as one or more close relatives with the same type of tumor, two or more relatives with tumors of the same localization or related to familial cancer syndromes, rare cancer forms, or three or more relatives in two generations with tumors of the same localization. Exclusion criteria included nonproliferative breast changes, absence of signs of genetic predisposition to breast disease, and patient refusal to participate.
The protocol research was approved by the Bioethics Commission of the Educational and Scientific Medical Institute of Sumy State University (No. 3, 05.12.22), and complies with the Order of the Ministry of Health of Ukraine No. 690 dated September 23, 2009 (about the approving of conducting of medicines clinical trials procedure and expertise of clinical trials materials, and the model regulations on Ethics Committees: Order of the Ministry of Health of Ukraine No. 690. September 23, 2009 Ukrainian) and the Declaration of Helsinki of the World Medical Association on the ethical principles of conducting scientific medical research involving human subjects. All participants provided written informed consent for the processing of personal data, blood sampling, and participation in genetic analysis. Patients were examined on an outpatient basis in the office of a surgeon who operates in accordance with licensing conditions (License Ag No. 600519) and were operated on at the clinical bases of the department of surgery with a course in pediatric surgery and urology, including the Sumy Regional Clinical Oncology Center (Sumy, Ukraine). Morphological material was studied at the Pathomorphological Research Center of the Pathological Anatomy Department of Sumy State University, and molecular‐genetic studies were conducted at the Scientific Laboratory of Molecular‐Genetic Research of Sumy State University.
3.2. Genotyping
DNA from blood leukocytes was extracted with the help of the commercial GeneJET Whole Blood Genomic DNA Purification Mini Kit (Thermo Fisher Scientific, United States). The genotyping of VDR gene polymorphic variant rs7975232 C/A marker was performed by the polymerase chain reaction (PCR) method followed by restriction fragment length polymorphism (RFLP) analysis, with detection through agarose gel electrophoresis. The amplification of the gene region containing the polymorphism site rs7975232 was carried out using a pair of specific primers: forward (sense) – 5 ^′^‐CAGAGCATGGACAGGGAGCAA‐3 ^′^ and reverse (antisense) –5 ^′^‐CACTTCGAGCACAAGGGGCGTTAGC‐3 ^′^. The primers were synthesized by Metabion (Germany). For amplification, 50–100 ng of DNA was taken and added to a mixture containing 5 μl of 5× PCR buffer, 1.5 mM magnesium sulfate, 250 μM of the four dNTPs, 15 pM of each primer, and 0.75 U of Taq polymerase (Fermentas, Lithuania). The total volume was brought up to 25 μl with deionized water. PCR was conducted in a GeneAmp PCR System 2700 thermocycler (Applied Biosystems, United States). The amplification program was as follows: denaturation at 94°C (50 s), primer annealing at 64.5°C (45 s), and elongation at 72°C (1 min), for a total of 33 cycles. Subsequently, 6 μl of the amplification product was incubated at 37°C for 20 h with 5 U of ApaI restriction enzyme in buffer B with the following composition: 10‐mM Tris‐HCl (pH 7.5), 10‐mM magnesium chloride, and 0.1‐mg/mL albumin. If there was a guanine at position 59979 of the VDR gene, the amplicon, which consisted of 501 base pairs, was cleaved by ApaI into two fragments—284 and 217 base pairs. If guanine was replaced with thymine, the restriction site for ApaI was lost, resulting in a single fragment of 501 base pairs (Figure 1).
Results of ApaI restriction analysis of the VDR gene polymorphism: Lanes 3, 4, and 7 correspond to the a/a genotype; 1, 6, 8, 10, and 11 to the a/A genotype; and 2, 5, and 9 to the A/A genotype.
The amplificates of the studied fragment of the VDR gene after restriction were separated in a 2.5% agarose gel containing ethidium bromide. Horizontal electrophoresis (0.1A; 140 V) was performed for 40 min. Visualization of DNA after electrophoresis was carried out using a transilluminator “Biocom”.
3.3. Data Analysis
Statistical analysis of the data was conducted with the SPSS software package (Statistical Package for the Social Sciences, Version 25.0, IBM, United States). To assess whether continuous data followed a normal distribution, the Kolmogorov–Smirnov test was applied. All continuous variables are reported as the mean and standard deviation (M ± SD). The Pearson χ ^2^ test was used to evaluate whether the frequency distribution of the rs7975232 genotypes VDR gene aligned with the Hardy–Weinberg equilibrium. A similar comparative analysis was also conducted to examine genotype distribution and other categorical variables across the study groups, using the χ ^2^ test. To compare the M values between two groups, the Student′s t‐test for independent samples was applied. When comparing the M values across three different rs7975232 genotypes, the ANOVA method was used, followed by the Bonferroni post hoc test for more detailed analysis. To evaluate the risk of BPBD complications in relation to the specific rs7975232 genotype, binary logistic regression was utilized. Multivariable logistic regression was employed to account for potential confounding factors such as sex, age, and body mass index. A p value below 0.05 was considered statistically significant across all tests.
4. Results
The distribution of VDR rs7975232 genotypes are as follows: in the control group a − allele frequency = 0.547 and A − allele = 0.453, in the BPBD group the frequency a − allele = 0.545 and A − allele = 0.455. The allele frequency distribution in the comparison groups aligns with the Hardy–Weinberg distribution (p = 0.963, χ ^2^ = 0.002).
Table 1 presents the outcomes of genotyping for the VDR gene rs7975232 in both cohorts.
No statistically significant differences were found in the distribution of genotypes and alleles between the comparison groups (p > 0.05).
Table 2 presents the results of the analysis of the association between genotypes for the rs7975232 polymorphism of the VDR gene and BPBD, conducted using binary and multivariable logistic regression within the framework of four inheritance models.
^a^The top row shows the results of comparing a/A versus a/a, and the bottom row shows A/A versus a/a.
In all inheritance models, both before and after adjusting for covariates (age and body mass index), there was no association found between the rs7975232 polymorphism and the risk of BPBD development (p > 0.05).
The subsequent stage of the analysis involved examining the risk of BPBD development in women across various age groups with diverse genotypes for the rs7975232 polymorphism of the VDR gene (Table 3).
^a^The top row shows the results of comparing a/A versus a/a., and the bottom row shows A/A versus a/a.
In the group with less than 40 years old according to the overdominant model, heterozygotes have a higher risk of developing BPBD than both homozygotes (p = 0.04). However, after adjusting for BMI, the association was no longer statistically significant (p = 0.16). In the group of patients aged 40 and older, according to the overdominant model, heterozygotes have a lower risk of developing BPBD compared with both homozygotes (p = 0.036). The statistically significant association remained after adjusting for BMI (p = 0.012). According to the recessive inheritance model, homozygotes for the recessive allele have a higher risk of developing BPBD compared with carriers of the major allele after adjusting for BMI (p = 0.033) (Table 3).
We also studied the association of the rs7975232 polymorphism in the VDR gene with disease duration, age at menarche onset, cycle length, and duration of menses in patients with BPBD. (Table 4).
It was found that among carriers of different genotypes for the rs7975232 polymorphism, patients with BPBD have differences in the duration of menses. Specifically, A/A homozygotes have a significantly shorter duration of menses compared with a/A heterozygotes (A/A = 24.8 ± 8.8, a/A = 27.8 ± 3.9; p = 0.024) (Table 4).
We also investigated the distribution of genotypes for the rs7975232 polymorphism of the VDR gene in patients with BPBD, considering other influencing factors, namely, severity of anamnesis, predisposing factors, smoking, gynecological pathology, hormone intake, presence of goiter, mastodynia, and estradiol levels (Table 5).
In the study of the distribution of genotype frequencies of the rs7975232 polymorphism in the VDR gene by family history burden in patients with BPBD, statistically significant differences were found. The frequency of patients with a family history burden in the A/A‐homozygote group was higher than in the a/A heterozygote and a/a homozygote groups (Table 5).
Statistically significant differences were also found in the presence of predisposing factors among genotypes of the VDR gene polymorphism. In patients with the A/A genotype, predisposing factors were more frequently present than in individuals with genotypes a/a and a/A (Table 5).
Statistically significant differences were found in blood estradiol levels between genotypes: Elevated estradiol levels were more frequently observed in carriers of the a/a genotype compared with a/A and A/A genotypes (Table 5).
When considering other factors such as smoking, presence of gynecological pathology, hormone intake, presence of goiter, and mastodynia in patients with BPBD, no statistically significant differences were found based on the genotype of the rs7975232 polymorphism (Table 5).
5. Discussion
The endocrine function of vitamin D is crucial for multiple biological processes, including regulation of bone metabolism, modulation of immune responses, and control of cell growth and differentiation [15]. Extensive genetic variability has been identified within the VDR, with more than 25,000 reported variants, although most remain functionally unexplored.
The VDR gene is located on Chromosome 12 (12q13.11) and consists of 11 exons and five promoter regions [16]. SNP rs7975232 involves a substitution of guanine with thymine in the eighth intron at position 59979. Although intronic polymorphisms do not alter the coding sequence, their proximity to regulatory regions allows them to serve as markers of functional interactions between other SNPs and pathological processes [17–19].
Polymorphisms in the VDR gene have been studied across different ethnic populations, demonstrating significant racial and ethnic differences in allele frequencies [18]. These disparities are attributed to evolutionary and population‐genetic processes. Consequently, individual polymorphisms may be associated with variable disease prevalence among ethnic groups.
Our study investigated the association of the rs7975232 polymorphism with BPBD in female patients from the Sumy region of Ukraine. This research addresses a notable gap, as no previous data exist on the role of this variant in Ukrainian women and only limited information is available regarding VDR polymorphisms in tumor‐related conditions within the Ukrainian population.
The analysis showed age‐dependent associations under the overdominant inheritance model. In patients younger than 40 years, heterozygotes had a higher BPBD risk compared with homozygotes (p = 0.04), but this association lost significance after adjustment for BMI (p = 0.16). In women aged 40 and older, heterozygotes demonstrated a lower BPBD risk (p = 0.036), which remained significant after BMI adjustment (p = 0.012). The recessive model also indicated increased BPBD risk in homozygotes for the recessive allele following BMI correction (p = 0.033). These findings suggest that genotype influences BPBD susceptibility, with age and BMI acting as important modifying factors.
Statistically significant differences were observed in genotype distribution, with a higher prevalence of family history burden in A/A homozygotes. Elevated estradiol levels and presence of predisposing factors were more common in certain genotypes, whereas no significant associations were detected with smoking, gynecological pathology, hormone intake, goiter, or mastodynia.
Previous international studies support the involvement of VDR polymorphisms and vitamin D signaling in breast cancer. Variants ApaI and TaqI have been linked to increased breast cancer risk [20], and deregulation of VDR and vitamin D metabolic enzymes (CYP27B1 and CYP24A1) has been shown to promote tumor progression [21]. In Ukraine, VDR gene polymorphisms have already been recognized as risk markers for several nontumor diseases, including generalized parodontitis [22] and ischemic atherothrombotic stroke [23], and are being evaluated as modifiers of hypertension risk in stroke patients [24]. The role of polymorphisms of hormone–receptor genes in breast pathology has also been investigated, particularly the VDR variants FokI, BsmI, ApaI and TaqI [24], as well as the PvuII polymorphism of the estradiol receptor alpha gene for diagnosis of proliferative forms of benign breast dysplasia [25].
Thus, the rs7975232 polymorphism appears to be a meaningful genetic marker in BPBD development among Ukrainian women. Investigation of additional VDR polymorphisms will allow identification of haplotypes associated with both BPBD and breast cancer [18].
6. Conclusions
This is the first case‐control study to analyze the relationship between VDR genetic polymorphism rs7975232 and BPBD in the Ukrainian population. It was found that in individuals under 40, heterozygotes have a higher risk of developing BPBD compared with both homozygotes (p = 0.04), but this association becomes insignificant after adjusting for BMI (p = 0.16). In those aged 40 and older, heterozygotes have a lower risk of developing BPBD compared with both homozygotes (p = 0.036), and this association remains significant even after BMI adjustment (p = 0.012). Additionally, homozygotes for the recessive allele have a higher risk of developing BPBD compared with carriers of the major allele after BMI adjustment (p = 0.033).
Thus, age and genetic model play crucial roles in the risk of developing BPBD, with BMI adjustment affecting statistical significance differently across age groups and genetic models.
Carriers of different genotypes for the rs7975232 polymorphism in the VDR gene show significant differences in the duration of menses among BPBD patients, with A/A homozygotes having a shorter duration compared with a/A heterozygotes (A/A = 24.8 ± 8.8, a/A = 27.8 ± 3.9; p = 0.024). Also, in patients with BPBD, the rs7975232 polymorphism of the VDR gene shows significant genotype‐based differences in family history burden, presence of predisposing factors, and blood estradiol levels, but not in smoking, gynecological pathology, hormone intake, goiter, or mastodynia.
Expanding the scope of research to include larger, multiethnic cohorts would provide valuable insights into population‐specific genetic variations and their implications for BPBD and other diseases. This approach could help distinguish universal patterns from region‐specific genetic predispositions, offering a deeper understanding of evolutionary factors shaping VDR polymorphism distributions. Additionally, longitudinal studies could shed light on the dynamic interplay between VDR polymorphisms, environmental exposures, and age‐related changes in breast tissue biology.
Author Contributions
Olha Obukhova: conceptualization, methodology, carried out molecular genetic studies, and writing—original draft. Mykola Kyrychenko: carried out molecular genetic studies and formal analysis. Ivan Lukavenko: data collection, analysis, and writing—review and editing. Viktoriia Yu. Harbuzova: conceptualization, supervision, project administration, and review and editing.
Funding
This study was supported by the Ministry of Education and Science of Ukraine (10.13039/501100007684) (No. 0123U101850).
Disclosure
The present study is part of the project supported by Ministry of Education and Science of Ukraine (No. 0123U101850).
Conflicts of Interest
The authors declare no conflicts of interest.
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1Dorjgochoo T. , Deming S. L. , Yu-Tang G. , Lu W. , Zheng Y. , Ruan Z. , Zheng W. , and Shu X. O. , History of Benign Breast Disease and Risk of Breast Cancer Among Women in China: A case-control Study, Cancer Causes & Control. (2008) 19, no. 8, 819–828, 10.1007/s 10552-008-9145-6, 2-s 2.0-52449099268, 18347922.18347922 PMC 2652858 · doi ↗ · pubmed ↗
- 2Hartmann L. C. , Sellers T. A. , Frost M. H. , Lingle W. L. , Degnim A. C. , Ghosh K. , Vierkant R. A. , Maloney S. D. , Pankratz V. S. , Hillman D. W. , and Suman V. J. , Benign Breast Disease and the Risk of Breast Cancer, New England Journal of Medicine. (2005) 353, no. 3, 229–237, 10.1056/NEJ Moa 044383, 2-s 2.0-22344434177.16034008 · doi ↗ · pubmed ↗
- 3Wang J. , Costantino J. P. , Tan-Chiu E. , Wickerham D. L. , Paik S. , and Wolmark N. , Lower-Category Benign Breast Disease and the Risk of Invasive Breast Cancer, Journal of the National Cancer Institute. (2004) 96, no. 8, 616–620, 10.1093/jnci/djhs 105, 2-s 2.0-2342624757, 15100339.15100339 · doi ↗ · pubmed ↗
- 4Sillanpää P. , Hirvonen A. , Kataja V. , Eskelinen M. , Kosma V. M. , Uusitupa M. , Vainio H. , and Mitrunen K. , Vitamin D Receptor Gene Polymorphism as an Important Modifier of Positive Family History Related Breast Cancer Risk, Pharmacogenetics. (2004) 14, no. 4, 239–245, 10.1097/00008571-200404000-00003, 2-s 2.0-1942467434, 15083068.15083068 · doi ↗ · pubmed ↗
- 5Serrano D. , Gnagnarella P. , Raimondi S. , and Gandini S. , Meta-Analysis on Vitamin D Receptor and Cancer Risk: Focus on the Role of Taq I, Apa I, and Cdx 2 polymorphisms, European Journal of Cancer Prevention. (2016) 25, no. 1, 85–96, 10.1097/CEJ.0000000000000132, 2-s 2.0-84948698515, 25738688.25738688 PMC 4885539 · doi ↗ · pubmed ↗
- 6Shao T. , Klein P. , and Grossbard M. L. , Vitamin D and Breast Cancer, The Oncologist. (2012) 17, no. 1, 36–45, 10.1634/theoncologist.2011-0278, 2-s 2.0-84856246076, 22234628.22234628 PMC 3267821 · doi ↗ · pubmed ↗
- 7Holick M. F. , Vitamin D Deficiency, New England Journal of Medicine. (2007) 357, no. 3, 266–281, 10.1056/NEJ Mra 070553, 2-s 2.0-34447514029.17634462 · doi ↗ · pubmed ↗
- 8Reimers L. L. , Crew K. D. , Bradshaw P. T. , Santella R. M. , Steck S. E. , Sirosh I. , Terry M. B. , Hershman D. L. , Shane E. , Cremers S. , Dworakowski E. , Teitelbaum S. L. , Neugut A. I. , and Gammon M. D. , Vitamin D-Related Gene Polymorphisms, Plasma 25-Hydroxyvitamin D, and Breast Cancer Risk, Cancer Causes & Control. (2015) 26, no. 2, 187–203, 10.1007/s 10552-014-0497-9, 2-s 2.0-84922104492, 25421379.25421379 PMC 4302042 · doi ↗ · pubmed ↗
