Correction to “A Barcoding‐Based Scat‐Analysis Assessment of Eurasian Otter Lutra lutra Diet on Kinmen Island”
Abstract
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsIsotope Analysis in Ecology · Environmental DNA in Biodiversity Studies · Animal Ecology and Behavior Studies
Jang‐Liaw, N.‐H. A Barcoding‐Based Scat‐Analysis Assessment of Eurasian Otter Lutra lutra Diet on Kinmen Island. Ecology and Evolution, 2021; 11: 8795–8813. https://doi.org/10.1002/ece3.7712
In Table 2 of the originally published article, the naming of the COI primer sequences FishR1 and FishF2 was incorrectly swapped for Set V and Set VI.
The sequence TCGACTAATCATAAAGATATCGGCAC, listed as FishR1 in Set V, is in fact the forward primer FishF2. Conversely, the sequence TAGACTTCTGGGTGGCCAAAGAATCA, listed as FishF2 in Set VI, is the reverse primer FishR1. The correct primer sequences are provided in the updated Table 2 below.
This correction pertains solely to the labeling of primer names in Table 2. The primer sequences themselves, laboratory procedures, and all analyses and conclusions presented in the article remain unchanged and are not affected by this error.
I apologize for this error.