Effects of dietary myo-inositol supplementation on the expression of fibroblast growth factor 23 (FGF23) and αKlotho in two commercial laying hen strains

TL;DR

This study examines how myo-inositol affects FGF23 and αKlotho gene expression in two types of laying hens, revealing strain-specific responses in phosphate regulation.

Contribution

The study provides new insights into the effects of myo-inositol on FGF23 and αKlotho in laying hens, highlighting strain-specific differences.

Findings

3 g/kg myo-inositol reduced hepatic FGF23 expression in Lohmann Brown hens.

Tibial FGF23 expression was lower in Lohmann LSL hens compared to Lohmann Brown hens.

Hepatic and tibial αKlotho expression varied between hen strains regardless of myo-inositol levels.

Abstract

Phosphate homeostasis is controlled by fibroblast growth factor 23 (FGF23) produced by bone cells in mammals and primarily acting in the kidney. For its phosphaturic effect and for suppression of production of active vitamin D, it requires αKlotho as a co-receptor. FGF23 and αKlotho have emerged as disease biomarkers. Relatively little is known about their significance in laying hens that are in particular need of balanced mineral homeostasis for eggshell formation. Dietary myo-inositol (MI) and phosphate metabolism are interdependent, and this study aimed to explore FGF23 and αKlotho expression in two commercial hen strains fed different amounts of MI. Forty Lohmann Brown Classic (LB) and Lohmann LSL-Classic (LSL) 26-week-old hens received standard diets with 0, 1, 2, or 3 g supplemental MI per kg feed for four weeks, and gene expression of FGF23 and αKlotho was measured by quantitative real-time PCR in different organs. Statistical analysis was performed with the MIXED procedure, and correlation analysis with markers of phosphate homeostasis and hepatic inflammation applying Pearson's correlation coefficient or Spearman's Rho. Three g supplemental MI per kg feed resulted in lower hepatic FGF23 expression only in LB hens. Regardless of MI supplementation, tibial FGF23 expression tended to be lower in LSL than LB hens. Moreover, supplemental MI did not significantly impact αKlotho expression, but hepatic αKlotho expression was higher in LSL than LB hens without MI supplementation and tibial and renal αKlotho expression was significantly higher in LB than in LSL hens, regardless of dietary MI. To summarize, MI supplements at 3 g/kg reduced hepatic FGF23 expression in LB, but not in LSL hens at the peak of egg-laying. Further studies might be needed to elucidate the effect before sexual maturity.

Figures

Hepatic and tibial FGF23 mRNA expression in two different laying hen strains fed diets with different *myo*-inositol levels.Fig 1: dummy alt textFGF23 gene expression in liver (A) and tibia (B) of laying hens of two different genetic backgrounds (Lohmann Brown-Classic (LB, black) or Lohmann LSL-Classic (LSL, white)) fed no supplemental *myo*-inositol (MI0), 1 g MI/kg (MI1), 2 g MI/kg (MI2) or 3 g MI/kg (MI3). Data are presented as arithmetic means ± SEM per group. Different superscripts indicate statistically significant differences between the experimental groups. Abbreviations: FGF23 = fibro

Plasma calcidiol levels of two different laying hen strains fed diets with different *myo*-inositol levels.Fig 3: dummy alt textPlasma calcidiol levels of laying hens of two different genetic backgrounds (Lohmann Brown-Classic (LB, black) or Lohmann LSL-Classic (LSL, white)) fed no supplemental *myo*-inositol (MI0), 1 g MI/kg (MI1), 2 g MI/kg (MI2) or 3 g MI/kg (MI3). Data are presented as arithmetic means ± SEM per group. Different superscripts indicate statistically significant differences between the experimental groups. Abbreviations: MI = *myo*-inositol; SEM = standard error of the mean..

Hepatic triglyceride content, hepatic IL-1β mRNA expression and plasma total cholesterol levels of two different laying hen strains fed diets with different *myo*-inositol levels.Fig 4: dummy alt textHepatic triglyceride content (A), hepatic IL-1β mRNA expression relative to GAPDH (B) and plasma total cholesterol (C) of laying hens of two different genetic backgrounds (Lohmann Brown-Classic (LB, black) or Lohmann LSL-Classic (LSL, white)) fed no supplemental *myo*-inositol (MI0), 1 g MI/kg (MI1), 2 g MI/kg (MI2) or 3 g MI/kg (MI3). Data on hepatic triglyceride content were already published in

Full text

Introduction

Fibroblast growth factor 23 (FGF23) is a regulator of phosphate, calcium, and vitamin D metabolism (Agoro and White, 2023; Shimada et al., 2005). Under physiological conditions in mammals, it is predominantly expressed by osteoblasts and osteocytes in bone and targets the kidney (Shimada et al., 2004). Major renal effects in mammals include the down-regulation of surface expression of NaPiIIa, the major Na^+^-dependent phosphate transporter (Gattineni et al., 2009), and the suppression of CYP27B1, the key enzyme for 1α-hydroxylation and activation of vitamin D (Shimada et al., 2004). Consequently, FGF23 increases phosphate excretion whilst lowering the plasma level of calcitriol (1,25(OH)2_D_3, active vitamin D) (Shimada et al., 2004). These effects are not only dependent on a protein of the FGF receptor family, but also require renal protein αKlotho as a co-receptor (Urakawa et al., 2006).

For both, FGF23 and αKlotho, roles in the pathophysiology of different organs (Semba et al., 2011), for life span and for health in general (Devi, 2025) have been established. The lack of either FGF23 or αKlotho results in a phenotype of strongly accelerated aging mainly due to derangements of phosphate and vitamin D metabolism (John et al., 2011). In addition, FGF23 may also be locally produced and mediate pathophysiological processes in further organs (e.g. induction of left ventricular hypertrophy or hepatic inflammation (Rausch and Föller, 2022)) in a αKlotho-independent manner. In contrast, αKlotho protein has been demonstrated to exert beneficial effects in the heart, central nervous system, or brain (Vogt and Föller, 2025) by targeting pathways that control fibrosis (Zhang et al., 2025), inflammation (Wei et al., 2025), or oxidative stress (Mercês et al., 2025).

Whereas these effects are described in mammals, comparatively little is known about the significance and regulation of both FGF23 and αKlotho in poultry. Phosphate and calcium metabolism is particularly critical in laying hens owing to daily eggshell formation and bone turnover (Whitehead, 2004). Similar to mammals, phosphate and calcium homeostasis are classically regulated by calcitriol and parathyroid hormone (PTH) in laying hens (Poorhemati et al., 2023). Moreover, also in birds functional FGF23 and αKlotho are existent, however, FGF23 expression is highest in the liver, while it is highest in bone in mammals (Wang et al., 2018). In poultry, NaPiIIa is also the most important phosphate transporter in the kidneys (Omotoso et al., 2023), and FGF23 induces urinary phosphate excretion in laying hens which is particularly relevant under conditions of high phosphate feeding (Wang et al., 2018). Conversely, dietary phosphate restriction lowers FGF23 expression in laying hens (Poorhemati et al., 2023).

Myo-inositol (MI) is supposed to be beneficial for health and performance of laying hens (Gonzalez-Uarquin et al., 2021). In principle, it can be generated in the digestive tract from dietary phytate if the enzyme phytase is present (Sommerfeld et al., 2018). However, since endogenous phytase activity has long been thought to be relatively low, the need for additional phytase supplements in the feed for MI production to appreciably occur in laying hens has been postulated (Sommerfeld et al., 2020). Phytate not only contains MI, but also phosphate which may additionally be a phosphate source (Mayer et al., 2023). Recent research uncovered that poultry may have appreciable intrinsic enzymatic activity for phytate breakdown in the intestinal tract which may offer the chance of lower dietary mineral phosphate supplementation for laying hens as phytate-bound phosphate may indeed be a larger source than has been thought before (Rodehutscord et al., 2023).

Some studies suggest that broilers supplemented with MI have an increased need for phosphate (Lee et al., 2017). Dietary MI and phosphate metabolism are interdependent (Gonzalez-Uarquin et al., 2020).

Our present study was performed to elucidate FGF23 and αKlotho gene expression in two commercial laying hen strains fed a standard diet without or with 1, 2, or 3 g MI supplement per kg feed. Since inflammation is a major trigger of FGF23 production (Yamazaki et al., 2015), we further analyzed hepatic interleukin-1β (IL-1β) expression (Yamazaki et al., 2015), as well as plasma total cholesterol levels (Puri et al., 2007) and hepatic triglyceride content (Mooli and Ramakrishnan, 2022) that may induce hepatic inflammation and studied their association with FGF23 and αKlotho expression.

Materials and methods

This study was part of the interdisciplinary Research Unit P-Fowl – Inositol phosphates and myo-inositol in the domestic fowl: Exploring the interface of genetics, physiology, microbiome, and nutrition (https://p-fowl.uni-hohenheim.de/). The animal trial was carried out at the Agricultural Experiment Station of the University of Hohenheim, Germany (Unterer Lindenhof, Eningen, Germany). The state of Baden-Württemberg (Project no. HOH67-21TE) approved the experiment, and it was conducted in accordance with Federal German Animal Welfare Legislation.

Animal trial and sample collection

The detailed experimental setup is published in Sommerfeld et al. (2025). Briefly, the factors hen strain and diet made up a 2 × 4 factorial design. A total of 240 female chickens per strain (Lohmann Brown Classic (LB) and Lohmann LSL-Classic (LSL)) were obtained from a commercial breeder (Lohmann Breeders GmbH, Cuxhaven, Germany). For each strain, eggs were produced by 12 unrelated roosters, and 20 offspring per rooster were initially selected. At 26 weeks of age, offspring of 10 roosters per strain were selected based on average body weight. A total of 40 LB and 40 LSL hens were placed in metabolism units (1 m x 1 m x 1 m) at 26 weeks of age in a randomized complete block design with one randomly chosen offspring per cage in one of ten blocks. Ten individual laying hens of each strain and diet were examined, resulting in 80 hens in total.

For 4 weeks, the hens were fed diets containing different amounts of supplemental myo-inositol (MI; Thermo Fisher, Kandel, Germany): no MI supplementation (MI0), 1 g/kg feed (MI1), 2 g/kg feed (MI2) and 3 g/kg feed (MI3). The diets mainly consisted of corn and soybean meal which was calculated to contain 2.2 g non-phytate phosphate per kg based on recent suggestions (Rodehutscord et al., 2023) and other nutrients at recommended levels according to the recommendations of the Gesellschaft für Ernährungsphysiologie (GfE) (Gesellschaft für Ernährungsphyisiologie, 1999). Ingredients, calculated and analyzed compositions are shown in Supplemental Table S1 and published in Sommerfeld et al. (2025). All animals had free access to water and feed until 2 h before slaughter when feed was deprived for 1 h, followed by ad libitum access again for 1 h to standardize gut fill for sampling of other traits for companion studies.

On 4 consecutive days, twenty hens per day were stunned with a gas mixture of 35 % CO_2_, 35 % N_2_ and 30 % O_2_ and sacrificed by decapitation. After being freed of the urethra, the right kidney was immediately put on dry ice. Muscle and connective tissue were removed from the tibia, and the epiphyses were cut off. It was cut in half to generate a proximal and distal half. Bone marrow and medullary bone were removed by rinsing with ice-cold 0.9 % saline. After cleaning, bones were immediately put on dry ice. For liver samples, pieces from the middle lobe were snap frozen in liquid nitrogen and stored on dry ice. For plasma measurements, trunk blood was collected in lithium-heparin tubes, centrifuged and plasma was frozen on dry ice. All samples were stored at -70°C until further processing.

Liver samples for measurement of hepatic gene expression and hepatic triglyceride content were all taken together, i.e. all parameters reported herein and used for correlation analyses were sampled and analyzed from the same 80 birds. Liver triglyceride content is already published in Szentgyörgyi et al. (2025) and was used for correlation analyses in this study while hepatic gene expression data were newly generated. Plasma was jointly taken on the day of sampling. While parameters of plasma phosphate and plasma calcium have already been published in Sommerfeld et al. (2025) and have been used in this study for correlation analysis, plasma total cholesterol and plasma calcidol levels were newly determined. All aforementioned companion studies involved the same animals.

RNA extraction and quantitative real-time PCR

For RNA isolation, kidney and bone (proximal tibia) samples were ground into powder with mortar and pestle in liquid nitrogen. PeqGOLD Trifast (Peqlab, VWR, Darmstadt, Germany) was used for kidney and liver samples and TRI reagent (Thermo Fisher Scientific, Waltham, MA, USA) for bone samples. RNA concentration and purity (260/280 and 260/230 absorbance ratios) were assessed using a Nanodrop Spectrometer (Thermo Fisher Scientific).

The DNA-free Kit (Thermo Fisher Scientific) was used for DNase treatment following the manufacturer’s guide in a total volume of 30 µl. The GoScript Reverse Transcription System using random primers (Promega, Mannheim, Germany) was used to synthesize first-strand complementary DNA (cDNA) from 800 ng RNA of proximal tibia tissue and 1.2 µg of liver and kidney tissue on a Biometra TAdvanced thermal cycler (Analytik Jena, Jena, Germany).

Gene expression levels of FGF23 and αKlotho (KL), with TATA-box binding protein (TBP) as the reference gene were determined by quantitative real-time PCR (qRT-PCR). Tibial and hepatic tissue was used for analysis of FGF23 gene expression as it exhibited the highest expression levels. Additionally, for αKlotho expression, renal tissue was analyzed as it is the tissue with the highest αKlotho expression (Wang et al., 2018). The reaction was conducted in a final volume of 20 µl, consisting of 2 µl cDNA, primers at concentrations of 0.25 pmol (for KL and FGF23) or 0.5 pmol (for TBP), 10 µl GoTaq qPCR MasterMix (Promega) and 6 or 7 µl nuclease-free water. Expression analysis was performed using a CFX Connect Real-Time System (Bio-Rad Laboratories, Feldkirchen, Germany). The cycling conditions included an initial denaturation at 95°C for 2 min, followed by 40 cycles of 95°C for 10 s, annealing at primer-specific temperature (FGF23: 61°C; KL: 61°C; TBP: 59°C) for 30 s, and extension at 72°C for 25 s. Negative controls included samples without reverse transcriptase treatment and DNase- and RNase-free water to test for impurities throughout the qRT-PCR preparation and run.

The primers used were as follows (5′ → 3′):

FGF23 (189 bp): CTCCTCTCCGCTGCTGAATC and TATTACACAGCCAGCACCCTC;

KL (107 bp): CCTTTGCCTGAAAACCAGCC and CGTCTGGTGAACATCCCACA;

TBP (182 bp): TGTGTCCACGGTGAATCTTG and GTTCCTCGCTTTTTGCTCCT.

Relative transcript levels of αKlotho (KL) and FGF23 were normalized to TBP expression, using the 2^-ΔCt^ method. The treatments did not significantly affect the cycle threshold (Ct) values of the reference gene (P > 0.05).

Hepatic triglyceride determination

Triglycerides were determined as previously described and published in Szentgyörgyi et al. (2025). Data on hepatic triglyceride content were used for correlations with gene expression analysis.

Biomark HD based quantitative real-time PCR for interleukin-1β (IL-1β)

For RNA extraction, 100 mg of liver tissue was homogenized using steel beads on a FastPrepTM FP120 (Thermo Electron Corporation, Karlsruhe, Germany), and Trizol Reagent (Thermo Fisher Scientific) was used according to the manufacturer’s protocol. The isolated RNA was dissolved in nuclease-free water, and its concentration and purity (260/280 and 260/230) were determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). RNA integrity was additionally verified in a randomly selected, representative subset of samples (including all treatments) by agarose gel electrophoresis (Aranda et al., 2012) and with a Qubit 4 fluorometer using the Qubit RNA IQ Assay Kit (#Q33221; Thermo Fisher Scientific).

Primers for the analysis of interleukin-1β (IL1B) (Dalgaard et al., 2015) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Borowska et al., 2019) as reference gene were adopted from previous studies.

The following primer sequences (5′ → 3′) were used:

GAPDH (150 bp): GAAGGCTGGGGCTCATCTG and CAGTTGGTGGTGCACGATG;

IL1B (93 bp): TCCTGGAGGAGGTTTTTGAG and AGGACTGTGAGCGGGTGTAG.

Primer specificity was verified by standard PCR using DreamTaq Green DNA Polymerase (Thermo Fisher Scientific) under the same conditions applied for the final analysis: 95°C for 2 min for denaturation, followed by 35 cycle of 95°C for 30 s, 60°C for 30 s, and 72°C for 1 min, and a final elongation step at 72°C for 5 min. PCR products were visualized by agarose gel electrophoresis, purified and subsequently sequenced bidirectionally using the Sanger method (Microsynth, Balgach, Switzerland).

Gene expression analysis was carried out on a Biomark HD system (Standard Bio Tools, South San Francisco, CA, USA) following the manufacturer’s protocols. To eliminate genomic DNA, 2 µg of total RNA was treated with DNase I (Thermo Fisher Scientific). CDNA was synthesized using the Reverse Transcription Master Mix (Standard Bio Tools) with 1 µl of DNase-treated RNA. A 15-cycle preamplification step was performed using 1.25 µl of cDNA, Preamp Master Mix (Standard Bio Tools) and a pooled primer mix containing all primers used in the final qPCR reactions. Excess primers were removed by exonuclease I digestion (New England Biolabs, Frankfurt am Main, Germany) and the pre-amplified samples were diluted fivefold.

Final qPCR assays were conducted on 96.96 Dynamic Array Integrated Fluidic Circuits (IFCs) for Gene Expression (Standard Bio Tools) using the Delta Gene Assays protocol and the manufacturer’s standard settings for fast PCR and melting curve analysis. Each IFC sample inlet was loaded with 5 µl of the exonuclease I-treated, pre-amplified and diluted sample mixed with SsoFast EvaGreen Supermix with Low ROX (Bio-Rad Laboratories) and DNA Binding Dye Sample Loading Reagent (Standard Bio Tools). Primer inlets were filled with 5 µl of primer mix (final concentration of 5 µM) prepared in Assay Loading Reagent (Standard Bio Tools) and DNA Suspension Buffer (Thermo Fisher Scientific), performing each run in triplicate. Negative controls were included throughout all preparation steps.

Data evaluation and quality control were performed using -Standard Bio Tools Real-Time PCR Analysis Software (version 1.0.2). The peak ratio threshold was set to 0.8 and the quality threshold to 0.65. Mean Ct values were calculated from technical triplicates. Expression levels of IL-1β were normalized to Ct values of the reference gene GAPDH using the 2^–ΔCt^ method.

Analysis of plasma parameters

Plasma calcidiol concentration was determined according to Qasir et al. (2025). The measurement of plasma phosphate and calcium concentrations was described in detail in the companion study of Sommerfeld et al. (2025).

Quantification of plasma cholesterol was performed using a commercial assay with the Fuji DriChem 4000i analyzer (Fujifilm, Tokyo, Japan).

Statistical analysis

To test for normality, the Kolmogorov-Smirnov test was used. Non-normally distributed data were transformed using the Box-Cox transformation. Comparisons were performed using the MIXED procedure and pairwise t-tests in SAS statistical software (version 9.4; SAS Institute Inc., Cary, NC, USA). The following statistical model used was:

$$[eqn]$$

with Y as relative gene expression, µ as overall mean, strain and diet as fixed effects, father and block as random effects and ε as residual error. Ten different fathers per strain and 10 different blocks were used as random effects. The random effect “father” was added to the statistical model as an overarching project design because part of the group focuses on genetics. This random effect was not further discussed in this study as it was out of scope.

To assess correlations of gene expression levels of FGF23 and αKlotho with other factors, Pearsons’s correlation was used for normally distributed data and Spearman’s rank if at least one parameter was not normally distributed. An individual hen was counted as one experimental unit. The Presented results are the arithmetic means and standard error of mean (SEM) per strain × diet group of untransformed data. Supplementary Tables S2 – S10 entail all presented results as the least squared (LS) means and pooled SEM. Statistical significance was set at P < 0.05.

Results

No strain × diet interaction could be seen for neither hepatic (P = 0.199; Fig. 1A) nor tibial FGF23 expression (P = 0.719; Fig. 1B). Hepatic FGF23 expression significantly decreased from MI0 to MI3 in LB hens (P = 0.031), but not in LSL hens (P = 0.538; Fig. 1A). LSL hens had lower tibial FGF23 expression than LB hens (P = 0.017; Fig. 1B) with a trend for higher hepatic FGF23 expression in LSL hens compared to LB hens (P = 0.084; Fig. 1A).Fig. 1. Hepatic and tibial FGF23 mRNA expression in two different laying hen strains fed diets with different myo-inositol levels.Fig 1: dummy alt textFGF23 gene expression in liver (A) and tibia (B) of laying hens of two different genetic backgrounds (Lohmann Brown-Classic (LB, black) or Lohmann LSL-Classic (LSL, white)) fed no supplemental myo-inositol (MI0), 1 g MI/kg (MI1), 2 g MI/kg (MI2) or 3 g MI/kg (MI3). Data are presented as arithmetic means ± SEM per group. Different superscripts indicate statistically significant differences between the experimental groups. Abbreviations: FGF23 = fibroblast growth factor 23; MI = myo-inositol; SEM = standard error of the mean; TBP = TATA-box binding protein.

We studied the effect of strain and diet on αKlotho expression in liver, tibia and kidney. No strain × diet interaction was seen for hepatic (P = 0.319; Fig. 2A), tibial (P = 0.912; Fig. 2B) or renal (P = 0.283; Fig. 2C) αKlotho expression. We did not observe a significant diet effect on hepatic (P = 0.966; Fig. 2A), tibial (P = 0.773; Fig. 2B) or renal (P = 0.249; Fig. 2C) αKlotho expression. Hepatic αKlotho expression showed a trend towards higher levels in LSL than in LB hens (P = 0.065; Fig. 2A) with a significant difference in the MI0 group (P = 0.024; Fig. 2A), while tibial (P < 0.001; Fig. 2B) and renal (P < 0.001; Fig. 2C) αKlotho expression were significantly higher in LB hens than in LSL hens.Fig. 2αKlotho mRNA expression in liver, tibia and kidney in two different laying hen strains fed diets with different myo-inositol levels.Fig 2: dummy alt textαKlotho gene expression in liver (A), tibia (B) and kidney (C) of laying hens of two different genetic backgrounds (Lohmann Brown-Classic (LB, black) or Lohmann LSL-Classic (LSL, white)) fed no supplemental myo-inositol (MI0), 1 g MI/kg (MI1), 2 g MI/kg (MI2) or 3 g MI/kg (MI3). Data are presented as arithmetic means ± SEM per group. Different superscripts indicate statistically significant differences between the experimental groups. Abbreviations: MI = myo-inositol; SEM = standard error of the mean; TBP = TATA-box binding protein.

To further characterize the role of FGF23 and αKlotho in phosphate metabolism, the correlation of FGF23 and αKlotho expression with parameters of mineral metabolism (plasma calcium, plasma phosphate and plasma calcidiol) was analyzed. Plasma phosphate and calcium levels were obtained and published in a companion study and neither diet nor strain had significant effects on either parameter (Sommerfeld et al., 2025). For plasma calcidiol levels, no diet × strain interaction could be seen (P = 0.998; Fig. 3). Diet had no effect on calcidiol levels (P = 0.720), but LB hens had significantly higher plasma calcidiol levels than LSL hens (P < 0.001; Fig. 3). In LB hens, a negative correlation between plasma phosphate and liver FGF23 expression (LB: ρ = -0.349, P = 0.027; LSL: ρ = 0.286, P = 0.082) and liver αKlotho expression (LB: ρ = -0.346, P = 0.029; LSL: ρ = -0.005, P = 0.975) was found (Table 1). Plasma calcium was negatively correlated with hepatic FGF23 expression only in LB hens (LB: ρ = -0.345, P = 0.029; LSL: ρ = 0.136, P = 0.415; Table 1). Plasma calcidiol showed positive correlations with tibia FGF23 expression (LB: ρ = 0.473, P = 0.004; LSL: ρ = 0.184, P = 0.369) and liver αKlotho (LB: ρ = 0.353, P = 0.025; LSL: ρ = 0.143, P = 0.392) expression only in LB hens, with liver FGF23 expression (LB: ρ = 0.318, P = 0.046; LSL: 0.477, P = 0.002) in both strains and with kidney αKlotho expression (LB: ρ = 0.146, P = 0.368; LSL: ρ = 0.581, P < 0.001) only in LSL hens (Table 1). Upon analysis of the different feeding groups, a positive correlation of plasma calcidiol and tibia FGF23 expression in MI0 and MI1 group and a trend for a positive correlation in the MI3 group but no such correlation in the MI2 group (MI0: ρ = 0.749, P = 0.002; MI1: ρ = 0.608, P = 0.010; MI2: ρ = -0.071; P = 0.795; MI3: ρ = 0.454, P = 0.090; Table 2) was revealed. Only in the MI1 group, a negative correlation between hepatic FGF23 expression and plasma phosphate (MI0: ρ = 0.227, P = 0.335; MI1: ρ = -0.566; P = 0.012; MI2: ρ = 0.158, P = 0.517; MI3: ρ = 0.143, P = 0.548) and plasma calcium (MI0: ρ = 0.032, P = 0.894; MI1: ρ = -0.556, P = 0.014; MI2: ρ = 0.117, P = 0.633; MI3: ρ = 0.172, P = 0.468) could be seen (Table 2).Fig. 3. Plasma calcidiol levels of two different laying hen strains fed diets with different myo-inositol levels.Fig 3: dummy alt textPlasma calcidiol levels of laying hens of two different genetic backgrounds (Lohmann Brown-Classic (LB, black) or Lohmann LSL-Classic (LSL, white)) fed no supplemental myo-inositol (MI0), 1 g MI/kg (MI1), 2 g MI/kg (MI2) or 3 g MI/kg (MI3). Data are presented as arithmetic means ± SEM per group. Different superscripts indicate statistically significant differences between the experimental groups. Abbreviations: MI = myo-inositol; SEM = standard error of the mean..Table 1. Correlation matrix of FGF23 expression levels in tibia and liver and αKlotho expression levels in tibia, liver, and kidney, and plasma phosphate, plasma calcium, plasma calcidiol, hepatic triglycerides per mg protein, liver IL-1β expression and plasma total cholesterol, separated for hen strain.Table 1: dummy alt textTibia FGF23 expression [a.u.]Liver FGF23 expression [a.u.]Tibia αKlotho expression [a.u.]Liver αKlotho expression [a.u.]Kidney αKlotho expression [a.u.]LB hensPlasma inorganic phosphate [mmol/l]1*0.196 ^S^-0.349 ^P,^0.041 ^P^-0.346 ^S,^-0.026 ^S^Plasma calcium [mmol/l]10.051 ^S^-0.345 ^P,^*0.194 ^P^-0.147 ^S^-0.105 ^S^*Plasma calcidiol [ng/ml]0.473 ^S,^⁎⁎*0.318 ^P,^*0.005 ^P^0.353 ^S,^0.146 ^S^Hepatic triglycerides [nmol/mg protein]20.217 ^S^**0.139 ^P^**0.175 ^P^**0.444 ^S,^⁎⁎*0.274 ^S^*Liver IL-1β expression [a.u.]*0.353 ^S,^*0.089 ^P^-0.206 ^P^-0.197 ^S^-0.215 ^S^Plasma total cholesterol [mg/dl]0.332 ^S,^0.008 ^S^0.017 ^S^-0.101 ^S^-0.282 ^S^**LSL hensPlasma inorganic phosphate [mmol/l]1-0.072 ^S^0.286 ^S^0.043 ^S^-0.005 ^S^-0.155 ^S^Plasma calcium [mmol/l]1-0.072 ^P^**0.136 ^P^**0.030 ^P^0.036 ^S^-0.198 ^S^Plasma calcidiol [ng/ml]0.184 ^P^**0.477 ^P,^⁎⁎0.376 ^P^**0.143 ^S^**0.581 ^S,^⁎⁎⁎Hepatic triglycerides [nmol/mg protein]20.214 ^P^0.009 ^P^-0.037 ^P^**0.107 ^S^0.018 ^S^*Liver IL-1β expression [a.u.]*0.006 ^P^0.031 ^P^-0.063 ^P^-0.045 ^S^**0.233 ^S^Plasma total cholesterol [mg/dl]-0.105 ^S^**0.081 ^S^0.152 ^S^0.145 ^S^-0.029 ^S^*Spearman’s rank correlation coefficient for not normally distributed data (^S^) or Pearson’s correlation coefficient (^P^) for normally distributed data.⁎P < 0.05.⁎⁎P < 0.01.⁎⁎⁎P < 0.001. Abbreviations: a.u. = arbitrary units; FGF23 = fibroblast growth factor 23; IL-1ß = interleukin-1ß; LB = Lohnmann Brown-Classic; LSL = Lohmann LSL-Classic. ^1^:1Data from Sommerfeld et al. (2025).2Data from Szentgyörgyi et al. (2025).Table 2. Correlation matrix of FGF23 expression levels in tibia and liver and αKlotho expression levels in tibia, liver, and kidney, and plasma phosphate, plasma calcium, plasma calcidiol, hepatic triglycerides, liver IL-1β expression and plasma total cholesterol, separated for dietary myo-inositol levels.Table 2: dummy alt textTibia FGF23 expression [a.u.]Liver FGF23 expression [a.u.]Tibia αKlotho expression [a.u.]Liver αKlotho expression [a.u.]Kidney αKlotho expression [a.u.]MI0Plasma inorganic phosphate [mmol/l]1*0.221 ^P^0.227 ^P^-0.018 ^P^-0.093 ^S^0.080 ^S^*Plasma calcium [mmol/l]10.031 ^P^0.032 ^P^-0.259 ^P^0.190 ^S^-0.227 ^S^Plasma calcidiol [ng/ml]0.749 ^P,^⁎⁎0.319 ^P^0.512 ^P^-0.142 ^S^**0.559 ^S,^**Hepatic triglycerides [nmol/mg protein]20.257 ^P^0.380 ^P^-0.218 ^P^**0.316 ^S^0.060 ^S^*Liver IL-1β expression [a.u.]*0.376 ^P^0.009 ^P^0.446 ^P^-0.297 ^S^0.236 ^S^Plasma total cholesterol [mg/dl]0.059 ^S^0.071 ^S^-0.117 ^S^0.020 ^S^-0.290 ^S^**MI1Plasma inorganic phosphate [mmol/l]1-0.148 ^S^-0.566 ^P,^*0.222 ^P^-0.109 ^S^-0.204 ^S^Plasma calcium [mmol/l]1-0.264 ^S^-0.556 ^P,^0.444 ^P^0.165 ^S^-0.176 ^S^Plasma calcidiol [ng/ml]0.608 ^S,^0.278 ^P^0.463 ^P^-0.298 ^S^0.420 ^S^Hepatic triglycerides [nmol/mg protein]2-0.007 ^S^-0.027 ^P^**0.025 ^P^0.384 ^S^0.245 ^S^*Liver IL-1β expression [a.u.]*0.279 ^S^0.217 ^P^-0.252 ^P^-0.495 ^S,^-0.066 ^S^*Plasma total cholesterol [mg/dl]*0.049 ^S^-0.313 ^P^**0.235 ^P^**0.219 ^S^**0.080 ^S^**MI2Plasma inorganic phosphate [mmol/l]1-0.049 ^P^**0.158 ^P^**0.046 ^P^**0.120 ^S^0.181 ^S^Plasma calcium [mmol/l]1-0.077 ^P^0.117 ^P^-0.025 ^P^-0.020 ^S^**0.109 ^S^Plasma calcidiol [ng/ml]-0.071 ^P^**0.261 ^P^**0.685 ^P,^⁎⁎0.053 ^S^0.314 ^S^Hepatic triglycerides [nmol/mg protein]20.506 ^P,^-0.044 ^P^-0.018 ^P^0.565 ^S,^-0.018 ^S^Liver IL-1β expression [a.u.]0.024 ^P^**0.002 ^P^0.650 ^P,^-0.300 ^S^0.143 ^S^Plasma total cholesterol [mg/dl]-0.1240.163-0.0660.112 ^S^**0.009 ^S^**MI3Plasma inorganic phosphate [mmol/l]1*0.595 ^S,^0.143 ^P^0.082 ^P^-0.592 ^S,^-0.271 ^S^Plasma calcium [mmol/l]10.493 ^S^0.172 ^P^0.164 ^P^-0.389 ^S^-0.202 ^S^*Plasma calcidiol [ng/ml]*0.454 ^S^-0.018 ^S^0.260 ^S^-0.026 ^S^**0.517 ^S,^*Hepatic triglycerides [nmol/mg protein]2-0.358 ^S^**0.142 ^P^**0.020 ^P^**0.167 ^S^0.063 ^S^*Liver IL-1β expression [a.u.]0.618 ^S,^-0.161 ^P^0.229 ^P^-0.389 ^S^**0.179 ^S^*Plasma total cholesterol [mg/dl]*0.527 ^S,^***0.322 ^P^0.268 ^P^-0.337 ^S^**0.009 ^S^*Spearman’s rank correlation coefficient for not normally distributed data (^S^) or Pearson’s correlation coefficient for normally distributed data (^P^).⁎: P < 0.05.⁎⁎: P < 0.01.Abbreviations: a.u. = arbitrary units; FGF23 = fibroblast growth factor 23; IL-1β = interleukin-1β; MI0 = 0 g myo-inositol/kg feed; MI1 = 1 g myo-inositol/kg feed; MI2 = 2 g myo-inositol/kg feed; MI3 = 3 g myo-inositol/kg feed.1: Data from Sommerfeld et al. (2025)2: Data from Szentgyörgyi et al. (2025).

Hepatic triglyceride content was measured in a companion study (Szentgyörgyi et al., 2025) and was neither associated with strain × diet interaction (P = 0.628), nor dietary MI (P = 0.617), nor strain (P = 0.469; Fig. 4A). Hepatic IL-1β expression was significantly higher in LB hens than in LSL hens (P < 0.001), while it was not associated with MI levels (P = 0.129) and there was no diet × strain interaction effect (P = 0.868; Fig. 4B). Plasma total cholesterol levels were not significantly affected by diet × strain interaction effect (P = 0.820) or strain (P = 0.210) whereas a trend towards higher total cholesterol with higher dietary MI levels could be verified (P = 0.074; Fig. 4C). In LB hens, liver fat content correlated with hepatic αKlotho expression (LB: ρ = 0.444, P = 0.004; LSL: ρ = 0.107, P = 0.530; Table 1). Hepatic IL-1β expression only showed a significant correlation with tibial FGF23 expression in LB hens as well (LB: ρ = 0.353, P = 0.035; LSL: ρ = 0.006, P = 0.978; Table 1). Moreover, an association between tibia FGF23 expression and plasma total cholesterol in LB but not in LSL hens was revealed (LB: ρ = 0.332, P = 0.048; LSL: ρ = -0.105, P = 0.611, Table 1). With both strains taken together, we observed a correlation of hepatic fat content with liver αKlotho expression (MI0: ρ = 0.316, P = 0.175; MI1: ρ = 0.384, P = 0.104; MI2: ρ = 0.565, P = 0.012; MI3: ρ = 0.167, P = 0.495) and tibia FGF23 expression (MI0: ρ = 0.257, P = 0.375; MI1: ρ = -0.007, P = 0.978; MI2: ρ = 0.506, P = 0.046; MI3: ρ = -0.358, P = 0.209) when supplemented with 2 g of MI per kg feed (Table 2). Hepatic IL-1β expression and liver αKlotho expression showed a negative correlation only in the MI1 group (MI0: ρ = -0.297, P = 0.203, MI1: ρ = -0.495, P = 0.031; MI2: ρ = -0.300, P = 0.212; MI3: ρ = -0.389, P = 0.090; Table 2). Furthermore, a correlation between hepatic IL-1β and tibia αKlotho expression could only be verified in the MI2 group (MI0: ρ = 0.446, P = 0.110; MI1: ρ = -0.252, P = 0.328; MI2: ρ = 0.650, P = 0.006; MI3: ρ = 0.229, P = 0.413) while liver expression of IL-1β was positively correlated with tibia FGF23 expression in the group receiving 3 g dietary MI per kg feed (MI0: ρ = 0.376, P = 0.185; MI1: ρ = 0.279, P = 0.277; MI2: ρ = 0.024, P = 0.931; MI3: ρ = 0.618, P = 0.014; Table 2). For plasma total cholesterol, there was a positive correlation between tibia FGF23 expression and plasma total cholesterol only in the MI3 group (MI0: ρ = 0.059, P = 0.840; MI1: ρ = 0.049, P = 0.852; MI2: ρ = -0.124, P = 0.648; MI3: ρ = 0.527; P = 0.043; Table 2).Fig. 4. Hepatic triglyceride content, hepatic IL-1β mRNA expression and plasma total cholesterol levels of two different laying hen strains fed diets with different myo-inositol levels.Fig 4: dummy alt textHepatic triglyceride content (A), hepatic IL-1β mRNA expression relative to GAPDH (B) and plasma total cholesterol (C) of laying hens of two different genetic backgrounds (Lohmann Brown-Classic (LB, black) or Lohmann LSL-Classic (LSL, white)) fed no supplemental myo-inositol (MI0), 1 g MI/kg (MI1), 2 g MI/kg (MI2) or 3 g MI/kg (MI3). Data on hepatic triglyceride content were already published in a companion study (Szentgyörgyi et al., 2025). Data are presented as arithmetic means ± SEM per group. Different superscripts indicate statistically significant differences between the experimental groups. Abbreviations: GAPDH = glyceraldehyde-3-phosphate dehydrogenase; IL-1β = interleukin-1β; MI = myo-inositol; ns = not significant; SEM = standard error of the mean.

Discussion

The present study was conducted to investigate the effect of dietary MI supplementation on the expression of FGF23 and αKlotho in two genetically distinct laying hen strains. Supplementation with MI at levels of 1, 2 or 3 g per kg did not elicit significant alterations in FGF23 or αKlotho expression relative to the control group receiving no additional MI. Notably, tibial FGF23, tibial αKlotho and renal αKlotho expression was elevated in LB hens compared to LSL hens.

This investigation represents the first to assess the potential regulatory influence of dietary MI on the expression of FGF23 and αKlotho in poultry. Previous research has indicated that MI supplementation under conditions of reduced dietary phosphorus and calcium improved body weight gain in broilers, while MI supplementation under adequate dietary calcium and phosphorus levels reduced growth rates of broilers (Cowieson et al., 2013). Furthermore, MI supplementation might increase phosphate requirements in broilers due to the necessity for re-phosphorylation of MI for functional activity (Lee et al., 2017). Given the established interplay between MI and phosphate metabolism (Gonzalez-Uarquin et al., 2020), we hypothesized that dietary MI levels could influence FGF23 expression in poultry, as plasma phosphate concentrations were previously positively correlated with FGF23 plasma levels in laying hens (Poorhemati et al., 2023). Sommerfeld et al. (2025) have shown that dietary MI levels ranging from 0 to 3 g MI per kg dry matter did not significantly impact plasma phosphate levels under conditions of adequate dietary phosphate supply. The diets enhanced plasma MI levels with no difference between MI2 and MI3. In our study, we neither saw an effect of dietary MI levels on tibial or hepatic FGF23 expression, nor on tibial, hepatic or renal expression levels of αKlotho. The lack of an effect on FGF23 and αKlotho expression levels in the current study may therefore be due to phosphate levels presumably not being affected by dietary MI levels in this study. Higher dietary MI levels might influence plasma phosphate levels which might in turn impact FGF23 and αKlotho levels.

Most poultry performance-related studies were conducted in broilers, where phosphate and calcium metabolism are predominantly associated with growth. However, laying hens undergo a metabolic shift post-maturation prioritizing egg production over skeletal development (Huneau-Salaün et al., 2011). This shift throughout the onset of lay to the peak of egg laying is associated with distinct gene expression patterns in e.g. jejunum, bone and alterations in systemic metabolite levels (Omotoso et al., 2021) even though phosphate play a crucial role in both, growth and calcium release for eggshell production (Rodehutscord et al., 2023). The influence of MI supplementation on factors revolving phosphate and calcium homeostasis might be higher during the growth phase of poultry than during eggshell calcification. Between the maturation phase from 19 to 24 weeks of age, we observed a shift in FGF23 expression sites which might hint at different functions of FGF23 expression sites at different production periods (Meier et al., 2025). Tibial FGF23 which was downregulated after the onset of lay might play a bigger role in phosphorus metabolism than hepatic FGF23 (Meier et al., 2025). It might therefore be possible that because eggshell formation is prioritized and tibial FGF23 was downregulated during the egg-laying phase, dietary MI supplementation did not impact FGF23 or αKlotho levels.

The observed strain-dependent differences in FGF23 and αKlotho expression, namely higher tibial FGF23, tibial αKlotho and renal αKlotho expression in LB hens, could be attributed to inherent physiological differences: LB hens exhibit higher calcidiol levels than LSL hens at 19 (Qasir et al., 2025), 24 (Omotoso et al., 2021; Qasir et al., 2025) and 60 (Omotoso et al., 2021) weeks of age and LSL hens show higher calcitriol levels in 60 week old animals (Omotoso et al., 2021). It is important to note that in the present study we only looked at cortical bone which is considered particularly important for bone strength in laying hens (Bishop et al., 2000). Elevated renal αKlotho expression in LB hens suggests that phosphorus homeostasis may be differentially regulated between the strains.

To further elucidate the hypothesis of different regulation of phosphorus metabolism between the strains, a correlation analysis was performed. We observed a significant negative correlation of liver FGF23 and liver αKlotho expression with plasma inorganic phosphate only in LB hens. In LSL hens, we only saw a trend for a negative correlation between liver FGF23 and plasma inorganic phosphate. Wang et al. (2018) discussed that bone FGF23 expression but not hepatic FGF23 expression was influenced by dietary phosphorus levels in Hy-Line Brown laying hens and saw a possibility for a phosphorus-independent role of hepatic FGF23 expression. Studies in mammals also hinted at hepatic FGF23 expression being increased in states of hepatic inflammation (Jung et al., 2022). Hepatic FGF23 expression and plasma phosphate exhibited a correlation only in the MI1 group regardless of strain. It is a surprising statistical finding that a correlation of FGF23 and phosphate could only be seen in the MI0 group. Since we did not observe a MI effect, such a correlation should theoretically be uniform in all groups, MI0-MI3. Among others, sample size and/or lack of statistical power may help explain the discrepancy.

In mammals, tibial FGF23 and renal αKlotho expression were potent regulators of calcidiol and calcitriol (Prié and Friedlander, 2010). Through renal αKlotho, FGF23 mediated the inhibition of CYP27B1 converting calcidiol into its active form calcitriol and induction of CYP24A1 leading to enhanced degradation of calcitriol (Dusso and Tokumoto, 2011). In LB hens, we observed a positive correlation of plasma calcidiol with tibia FGF23 expression and in LSL hens between plasma calcidiol and αKlotho in the kidney. A positive correlation of calcidiol and tibial FGF23 expression levels suggests that high tibial FGF23 levels lead to decreased synthesis and increased degradation of calcitriol which may lead to increased levels of calcidiol.

Emerging evidence suggests that MI may also possess anti-inflammatory properties (Arefhosseini et al., 2023; Quecchia and Vianello, 2025). Although the role of hepatic αKlotho expression in laying hens remains undefined, it may have similar immunomodulatory functions as observed in mammals (Prud'homme and Wang, 2024). Gene expression analysis in this study indicated a trend towards higher hepatic αKlotho expression in LSL hens compared to LB hens. Furthermore, previous studies reported up-regulated inflammatory markers in LB hens (Iqbal et al., 2022; Schmucker et al., 2021) and LB hens exhibited a metabolite profile which suggested enhanced metabolic inflammation (Szentgyörgyi et al., 2025). This was corroborated by increased hepatic IL-1β expression levels in LB hens compared to LSL hens. In our study, a positive trend in hepatic FGF23 expression in response to elevated MI supplementation was observed only in LB hens between MI0 and MI3 group. This suggests that LB hens may derive greater benefit from dietary MI due to a predisposition towards a pro-inflammatory phenotype. Furthermore, tibial FGF23 and hepatic IL-1β expression correlated only in LB hens. These findings on hepatic FGF23 and αKlotho expression and tibial FGF23 expression imply that MI supplementation supports inflammatory pathways in LB hens through FGF23 and αKlotho regulation, but not in LSL hens. It is also possible that in LB hens an increase in dietary MI modulates the involvement of FGF23 in immune processes.

We did not find a significant effect of MI supplementation on plasma total cholesterol but a significant increase in plasma cholesterol between MI0 and MI2/MI3, suggesting that higher levels of MI supplementation (2 or 3 g/kg feed) were associated with higher plasma cholesterol levels while 1 g MI/kg feed was not. Cholesterol esters are mainly synthesized in the livers of laying hens where they function as precursors of egg yolk cholesterol (Li et al., 2015). It is important to note that laying hens almost exclusively rely on the de novo synthesis of cholesterol due to the lack of animal products in their diet (Liu et al., 2010). Due to cholesterol’s strong contribution to egg yolk synthesis, it can be assumed that higher plasma cholesterol levels in the MI2 and MI3 group compared to the MI0 group might aid egg yolk synthesis. This effect did not lead to improvement of performance parameters (Sommerfeld et al., 2025) and physiological relevance of increased plasma cholesterol levels have to be further studied, especially due to its role as a precursor of vitamin D (Tieu et al., 2012) and estrogen (Cui et al., 2013).

Different dietary MI levels did not alter hepatic IL-1β expression or hepatic triglyceride content. Hepatic IL-1β expression was not significantly different before and after the onset of lay (Meier et al., 2025), either. Therefore, supplementation of MI in 30-week-old hens did not impact those parameters of liver inflammation at peak egg production.

A possible limitation of this study is that no bone or liver weight was determined, so dilution by weight could have potentially influenced expression differences.

Conclusion

High levels of dietary MI reduced hepatic FGF23 expression only in LB hens, with no significant effects in LSL hens. This strain-specific response may indicate that LB hens benefit more from MI supplementation, potentially due to an inherently enhanced pro-inflammatory physiological state. Differences in renal αKlotho expression further suggest distinct regulatory mechanisms of phosphorus homeostasis between the two genotypes. Although both strains show similar performance traits, these findings point to underlying physiological divergence. The impact of dietary MI on phosphate- and calcium-related pathways may also be more pronounced during the growth phase than during peak eggshell formation. Additional studies conducted before the onset of lay are needed to confirm this hypothesis.

CRediT authorship contribution statement

Leonie Meier: Writing – original draft, Software, Methodology, Formal analysis, Data curation. Ákos Szentgyörgyi: Writing – original draft, Methodology, Formal analysis, Data curation. Nadine Wallauch: Writing – original draft, Methodology, Data curation. Martina Feger: Writing – review & editing, Project administration, Funding acquisition, Conceptualization. Michael Oster: Writing – review & editing, Resources, Funding acquisition, Data curation, Conceptualization. Vera Sommerfeld: Writing – review & editing, Project administration, Funding acquisition, Conceptualization. Sonja Schmucker: Writing – review & editing, Methodology, Data curation. Korinna Huber: Writing – review & editing, Funding acquisition, Data curation, Conceptualization. Volker Stefanski: Writing – review & editing, Data curation. Klaus Wimmers: Writing – review & editing, Funding acquisition, Conceptualization. Markus Rodehutscord: Writing – review & editing, Project administration, Funding acquisition, Conceptualization. Michael Föller: Writing – review & editing, Writing – original draft, Supervision, Resources, Funding acquisition, Conceptualization.

Disclosures

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: Leonie Meier reports financial support was provided by German Research Foundation. Ákos Szentgyörgyi reports financial support was provided by German Research Foundation. Martina Feger reports financial support was provided by German Research Foundation. Michael Oster reports financial support was provided by German Research Foundation. Vera Sommerfeld reports financial support was provided by German Research Foundation. Klaus Wimmers reports financial support was provided by German Research Foundation. Korinna Huber reports financial support was provided by German Research Foundation. Markus Rodehutscord reports financial support was provided by German Research Foundation. Michael Föller reports financial support was provided by German Research Foundation. Michael Föller reports a relationship with Kyowa Kirin that includes: speaking and lecture fees.