Morpho-phylogenetic evidence reveals five novel species of Pestalotiopsis (Sporocadaceae, Amphisphaeriales) from southern China

Abstract

Figures

A maximum-likelihood phylogenetic tree of Pestalotiopsis constructed based on concatenated sequence data of ITS, tef1-α, and tub2. Bootstrap support values for ML greater than 80% and Bayesian posterior probabilities greater than 0.95 are shown near the nodes. The tree is rooted with Nonappendiculata quercina (CBS 116061 and CBS 270.82). New strains identified in this study are shown in blue; new species are shown in red. Some branches were shortened according to the indicated multipliers, and these are indicated by the symbol (//).

Pestalotiopsis acericola (HJAUP C1856.1, ex-type). a, b. Leaf of host plant (front and reverse); c, d. Culture on PDA (front and reverse); e, f. Conidiomata; g, h. Conidiogenous cells and conidia; i–p. Conidia. Scale bars: 400 µm (e, f); 20 µm (g, h); 10 µm (i–p).

Pestalotiopsis corchorifolii (HJAUP C1891.1, ex-type). a, b. Leaf of host plant (front and reverse); c, d. Culture on PDA (front and reverse); e, f. Conidiomata; g, h. Conidiogenous cells and conidia; i–p. Conidia. Scale bars: 200 µm (e, f); 10 µm (g–p).

Pestalotiopsis fraseri (HJAUP C1693.1, ex-type). a, b. Leaf of host plant (front and reverse); c, d. Culture on PDA (front and reverse); e, f. Conidiomata; g–i. Conidiogenous cells and conidia; j–q. Conidia. Scale bars: 200 µm (e, f); 10 µm (g–q).

Pestalotiopsis goeppertiae (HJAUP C1919.1, ex-type). a, b. Leaf of host plant (front and reverse); c, d. Culture on PDA (front and reverse); e, f. Conidiomata; g–i. Conidiogenous cells and conidia; j–q. Conidia. Scale bars: 200 µm (e, f); 20 µm (g–i); 10 µm (j–q).

Pestalotiopsis koelreuteriae (HJAUP C2757.1, ex-type). a, b. Leaf of host plant (front and reverse); c, d. Culture on PDA (front and reverse); e. Conidiomata; f. Conidiogenous cells and conidia; g–p. Conidia. Scale bars: 200 µm (e); 10 µm (f–p).

Pestalotiopsis machiliana (HJAUP C2801.1). a, b. Leaf of host plant (front and reverse); c, d. Culture on PDA (front and reverse); e–f. Conidiomata; g. Conidiogenous cells and conidia; h–o. Conidia. Scale bars: 200 µm (e, f); 10 µm (g–o).

Tables

Table 1.. Primers and PCR program used in this study.

Locus	Primers		PCR program
	Name	Sequence 5'–3'
ITS	ITS5	GGAAGTAAAAGTCGTAACAAGG	95 °C: 3 min, (95 °C: 15 s, 54 °C: 15 s, 72 °C: 30 s) × 35 cycles, 72 °C: 5 min
	ITS4	TCCTCCGCTTATTGATATGC
tef1-α	EF1-728F	CATCGAGAAGTTCGAGAAGG	95 °C: 3 min, (95 °C: 15 s, 56 °C: 15 s, 72 °C: 30 s) × 35 cycles, 72 °C: 5 min
	EF1-986R	TACTTGAAGGAACCCTTACC
tub2	Bt2a	GGTAACCAAATCGGTGCTGCTTTC	95 °C: 3 min, (95 °C: 15 s, 54 °C: 15 s, 72 °C: 30 s) × 35 cycles, 72 °C: 5 min
	Bt2b	ACCCTCAGTGTAGTGACCCTTGGC

Table 2.. Pestalotiopsis species with their GenBank accession numbers used in the phylogenetic analyses of this study. New sequences are in bold.

Species	Strain number	Host/substrate	Locality	GenBank accession number			References
				ITS	tef1-α	tub2
Pestalotiopsis abietis	CFCC 53011T	Abies fargesii	China	MK397013	MK622277	MK622280	Gu et al. (2021)
P. abietis	CFCC 53012	Abies fargesii	China	MK397014	MK622278	MK622281
P. adusta	ICMP 6088T	Refrigerator door	Fiji	JX399006	JX399070	JX399037	Maharachchikumbura et al. (2012)
P. acericola	HJAUP C1856.1T	Acer buergerianum	China	PX613543	PX617762	PX625971	This study
P. acericola	HJAUP C1856.2	Acer buergerianum	China	PX613544	PX617763	PX625972
P. acericola	HJAUP C1856.3	Acer buergerianum	China	PX613545	PX617764	PX625973
P. acericola	HJAUP C1856.4	Acer buergerianum	China	PX613546	PX617765	PX625974
P. aggestorum	LC 6301T	Camellia sinensis	China	KX895015	KX895234	KX895348	Liu et al. (2017)
P. aggestorum	LC 8186	Camellia sinensis	China	KY464140	KY464150	KY464160
P. alloschemones	CGMCC 3.23480T	Alloschemone occidentalis	China	OR247981	OR361456	OR381056	Razaghi et al. (2024)
P. alpinicola	HJAUP C1644.221T	Alpinia zerumbet	China	PP962274	PP952249	PP952219	Luo et al. (2024)
P. alpinicola	HJAUP C1644.222	Alpinia zerumbet	China	PP962275	PP952248	PP952220
P. americana	CBS 111576T	Leucospermum cunei × conocarpodendron	USA	MH553961	MH554379	MH554620	Liu et al. (2019)
P. anacardiacearum	IFRDCC 2397T	Mangifera indica	China	KC247154	KC247156	KC247155	Maharachchikumbura et al. (2013a)
P. anhuiensis	CFCC 54791T	Cyclobalanopsis glauca	China	ON007028	ON005045	ON005056	Jiang et al. (2022a)
P. aporosae-dioicae	SAUCC224004T	Aporosa dioica	China	OR733506	OR912988	OR912985	Yin et al. (2024)
P. aporosae-dioicae	SAUCC224005	Aporosa dioica	China	OR733505	OR912989	OR912986
P. appendiculata	CGMCC 3.23550T	Rhododendron decorum	China	OP082431	OP185509	OP185516	Gu et al. (2022)
P. arceuthobii	CBS 434.65T	Arceuthobium campylopodum	USA	KM199341	KM199516	KM199427	Maharachchikumbura et al. (2014)
P. arengae	CBS 331.92T	Arenga undulatifolia	Singapore	KM199340	KM199515	KM199426	Maharachchikumbura et al. (2014)
P. australasiae	CBS 114126T	Knightia sp.	New Zealand	KM199297	KM199499	KM199409	Maharachchikumbura et al. (2014)
P. australasiae	CBS 114141	Protea sp.	New South Wales	KM199298	KM199501	KM199410
P. australis	CBS 111503	Protea neriifolia × susannae cv. ‘Pink Ice’	South Africa	KM199331	KM199557	KM199382	Maharachchikumbura et al. (2014)
P. australis	CBS 114193T	Grevillea sp.	New South Wales	KM199332	KM199475	KM199383
P. biappendiculata	CGMCC 3.23487T	Rhododendron sp.	China	OR247984	OR361459	OR381059	Razaghi et al. (2024)
P. biappendiculata	LC4282	Rhododendron sp.	China	OR247990	OR361465	OR381065
P. biappendiculata	LC4283	Rhododendron sp.	China	OR247991	OR361466	OR381066
P. biciliata	CBS 124463T	Platanus × hispanica	Slovakia	KM199308	KM199505	KM199399	Maharachchikumbura et al. (2014)
P. biciliata	CBS 236.38	Paeonia sp.	Italy	KM199309	KM199506	KM199401
P. brachiata	LC 2988T	Camellia sp.	China	KX894933	KX895150	KX895265	Liu et al. (2017)
P. brachiata	LC 8188	Camellia sp.	China	KY464142	KY464152	KY464162
P. brachiata	LC 8189	Camellia sp.	China	KY464143	KY464153	KY464163
P. brassicae	CBS 170.26T	Brassica napus	New Zealand	KM199379	KM199558	–	Maharachchikumbura et al. (2014)
P. buxicola	CFCC 57357T	Buxus bodinieri	China	PP965518	PP957899	PP957901	Jiang et al. (2025)
P. buxicola	CFCC 57358	Buxus bodinieri	China	PP965519	PP957900	PP957902
P. camelliicola	HJAUP C1804.221T	Camellia japonica	China	PP962357	PP952236	PP952229	Luo et al. (2024)
P. camelliicola	HJAUP C1804.222	Camellia japonica	China	PP962358	PP952235	PP952230
P. camelliae	MFLUCC 12–0277T	Camellia japonica	China	JX399010	JX399074	JX399041	Zhang et al. (2012a)
P. camelliae–oleiferae	CSUFTCC 08T	Camelliae oleiferae	China	OK493593	OK507963	OK562368	Li et al. (2021)
P. camelliae–oleiferae	CSUFTCC 09	Camelliae oleiferae	China	OK493594	OK507964	OK562369
P. cangshanensis	CGMCC 3.23544T	Rhododendron delavayi	China	OP082426	OP185510	OP185517	Gu et al. (2022)
P. castanopsidis	CFCC 54430T	Castanopsis lamontii	China	OK339732	OK358493	OK358508	Jiang et al. (2022a)
P. castanopsidis	CFCC 54305	Castanopsis hystrix	China	OK339733	OK358494	OK358509
P. castanopsidis	CFCC 54384	Castanopsis hystrix	China	OK339734	OK358495	OK358510
P. chamaeropis	CBS 186.71T	Chamaerops humilis	Italy	KM199326	KM199473	KM199391	Maharachchikumbura et al. (2014)
P. chamaeropis	CFCC 55122	Quercus aliena	China	OM746229	OM840001	OM839902	Jiang et al. (2022b)
P. chamaeropis	CFCC 55023	Castanopsis fissa	China	OM746233	OM840005	OM839906
P. changjiangensis	CFCC 54314T	Castanopsis tonkinensis	China	OK339739	OK358500	OK358515	Jiang et al. (2022a)
P. changjiangensis	CFCC 54433	Castanopsis hainanensis	China	OK339740	OK358501	OK358516
P. changjiangensis	CFCC 52803	Cyclobalanopsis austrocochinchinensis	China	OK339741	OK358502	OK358517
P. chaoyangensis	CFCC 55549T	Euonymus japonicus	China	OQ344763	OQ410582	OQ410584	Lin et al. (2023)
P. chaoyangensis	CFCC 58805	Euonymus japonicus	China	OQ344764	OQ410583	OQ410585
P. chiangmaiensis	MFLUCC 22–0127T	Phyllostachys edulis	Thailand	OP497990	OP753374	OP752137	Sun et al. (2023)
P. chiaroscuro	BRIP 72970T	Sporobolus natalensis	Australia	OK422510	OK423753	OK423752	Crous et al. (2022)
P. chinensis	MFLUCC 12–0273T	NA	China	JX398995	–	–	Maharachchikumbura et al. (2012)
P. clavata	MFLUCC 12–0268T	Buxus sp.	China	JX398990	JX399056	JX399025	Maharachchikumbura et al. (2012)
P. colombiensis	CBS 118553T	Eucalyptus urograndis	Colombia	KM199307	KM199488	KM199421	Maharachchikumbura et al. (2014)
P. corchorifolii	HJAUP C1891.1T	Rubus corchorifolius	China	PX613547	PX617766	PX625975	This study
P. corchorifolii	HJAUP C1891.2	Rubus corchorifolius	China	PX613548	PX617767	PX625976
P. corchorifolii	HJAUP C1891.3	Rubus corchorifolius	China	PX613549	PX617768	PX625977
P. corchorifolii	HJAUP C1891.4	Rubus corchorifolius	China	PX613550	PX617769	PX625978
P. corchorifolii	HJAUP C1891.5	Rubus corchorifolius	China	PX613551	PX617770	PX625979
P. cratoxyli	CGMCC 3.23512T	Cratoxylum cochinchinense	China	OR248005	OR361480	OR381080	Razaghi et al. (2024)
P. cratoxyli	LC8772	Cratoxylum cochinchinense	China	OR248004	OR361479	OR381079
P. cyclobalanopsidis	CFCC 54328T	Cyclobalanopsis glauca	China	OK339735	OK358496	OK358511	Jiang et al. (2022a)
P. cyclobalanopsidis	CFCC 55891	Cyclobalanopsis glauca	China	OK339736	OK358497	OK358512
P. cyclosora	HJAUP C1724.221T	Cyclosorus interruptus	China	PP962279	PP952247	PP952221	Luo et al. (2024)
P. cyclosora	HJAUP C1724.222	Cyclosorus interruptus	China	PP962280	PP952246	PP952222
P. cyclosora	HJAUP C1725.221	Microlepia marginata	China	PP962281	PP952245	PP952223
P. cyclosora	HJAUP C1725.222	Microlepia marginata	China	PP962282	PP952244	PP952233
P. cyclosora	HJAUP C1726.221	Punica granatum	China	PP962283	PP952243	PP952224
P. cyclosora	HJAUP C1726.222	Punica granatum	China	PP962284	PP952242	PP952232
P. daliensis	CGMCC 3.23548T	Rhododendron decorum	China	OP082429	OP185511	OP185518	Gu et al. (2022)
P. dianellae	CBS 143421T	Dianella sp.	Australia	MG386051	–	MG386164	Crous et al. (2017)
P. digitalis	MFLU 14–0208T	Digitalis purpurea	New Zealand	KP781879	–	KP781883	Liu et al. (2015)
P. dilucida	LC3232T	Camellia sinensis	China	KX894961	KX895178	KX895293	Liu et al. (2017)
P. dilucida	LC8184	Camellia sinensis	China	KY464138	KY464148	KY464158
P. diploclisiae	CBS 115587T	Diploclisia glaucescens	China	KM199320	KM199486	KM199419	Maharachchikumbura et al. (2014)
P. disseminata	CBS 143904	Persea americana	New Zealand	MH554152	MH554587	MH554825	Liu et al. (2019)
P. disseminata	MEAN 1165	Pinus pinea	Portugal	MT374687	MT374699	MT374712	Silva et al. (2020)
P. diversiseta	MFLUCC 12–0287T	Rhododendron sp.	China	JX399009	JX399073	JX399040	Maharachchikumbura et al. (2012)
P. doitungensis	MFLUCC 14–0115	Dendrobium sp.	Thailand	MK993574	MK975832	MK975837	Ma et al. (2019)
P. dracaenae	HGUP 4037T	Dracaena fragrans	China	–	MT598644	MT598645	Ariyawansa et al. (2015)
P. dracaenicola	MFLUCC 18–0913T	Dracaena sp.	Thailand	MN962731	MN962732	MN962733	Chaiwan et al. (2020)
P. dracaenicola	MFLUCC 18–0914	Dracaena sp.	Thailand	MN962734	MN962735	MN962736
P. dracontomelonis	MFLU 14–0207	Dracontomelon dao	Thailand	KP781877	KP781880	–	Liu et al. (2015)
P. eleuthero–cocci	HMJAU 60189T	Eleutherococcus brachypus	China	OL996126	–	–	Tian et al. (2022)
P. eleuthero–cocci	HMJAU 60190	Eleutherococcus brachypus	China	OL996127	–	OL898722
P. endophytica	MFLUCC 18–0932T	Magnolia garrettii	Thailand	MW263946	MW417119	–	de Silva et al. (2021)
P. endophytica	MFLUCC 18–0946	Magnolia garrettii	Thailand	MW263947	MW729384	–
P. ericacearum	IFRDCC 2439T	Rhododendron delavayi	China	KC537807	KC537814	KC537821	Zhang et al. (2013)
P. eriobotryae	HJAUP C1742.221T	Eriobotrya japonica	China	PP962289	PP952238	PP952227	Luo et al. (2024)
P. eriobotryae	HJAUP C1742.222	Eriobotrya japonica	China	PP962291	PP952237	PP952228
P. etonensis	BRIP 66615T	Sporobolus jacquemontii	Australia	MK966339	MK977635	MK977634	Crous et al. (2020)
P. exudata	CGMCC 3.23488T	Aucuba japonica	China	OR247985	OR361460	OR381060	Razaghi et al. (2024)
P. exudata	LC15850	Aucuba japonica	China	OR247986	OR361461	OR381061
P. ficicrescens	HGUP 861T	Camellia japonica	China	MZ477311	MZ868328	MZ868301	Hyde et al. (2023)
P. ficicrescens	CGMCC 3.23471	Oleaceae	China	OR247980	OR361455	OR381055	Razaghi et al. (2024)
P. foliicola	CFCC 54440T	Castanopsis faberi	China	ON007029	ON005046	ON005057	Jiang et al. (2022a)
P. foliicola	CFCC 57359	Castanopsis faberi	China	ON007030	ON005047	ON005058
P. foliicola	CFCC 57360	Castanopsis faberi	China	ON007031	ON005048	ON005059
P. formosana	NTUCC 17–009T	Poaceae sp.	China	MH809381	MH809389	MH809385	Ariyawansa and Hyde (2018)
P. formosana	NTUCC 17–010	Poaceae sp.	China	MH809382	MH809390	MH809386
P. fraseri	HJAUP C1693.1T	Photinia × fraseri	China	PX613552	PX617771	PX625980	This study
P. fraseri	HJAUP C1693.2	Photinia × fraseri	China	PX613553	PX617772	PX625981
P. fraseri	HJAUP C1693.3	Photinia × fraseri	China	PX613554	PX617773	PX625982
P. fraseri	HJAUP C1693.4	Photinia × fraseri	China	PX613555	PX617774	PX625983
P. furcata	MFLUCC 12–0054T	Camellia sinensis	Thailand	JQ683724	JQ683740	JQ683708	Maharachchikumbura et al. (2013b)
P. furcata	LC6691	Camellia sinensis	China	KX895030	KX895248	KX895363	Liu et al. (2017)
P. fusiformis	CGMCC 3.23495T	Rhododendron sp.	China	OR247995	OR361470	OR381070	Razaghi et al. (2024)
P. fusiformis	LC15852	Rhododendron sp.	China	OR247996	OR361471	OR381071
P. fusoidea	CGMCC 3.23545T	Rhododendron delavayi	China	OP082427	OP185512	OP185519	Gu et al. (2022)
P. ganzhouensis	CGMCC 3.23489T	Cinnamomum camphora	China	OR247987	OR361462	OR381062	Razaghi et al. (2024)
P. ganzhouensis	LC5089	Cinnamomum camphora	China	OR247998	OR361473	OR381073
P. gardeniae	HJAUP C1729.221T	Gardenia jasminoides	China	PP962285	PP952241	PP952225	Luo et al. (2024)
P. gardeniae	HJAUP C1729.222	Gardenia jasminoides	China	PP962286	PP952240	PP952226
P. gardeniae	HJAUP C1729.223	Gardenia jasminoides	China	PP962287	PP952239	PP952231
P. gaultheriae	IFRD 411–014T	Gaultheria forrestii	China	KC537805	KC537812	KC537819	Zhang et al. (2013)
P. gibbosa	NOF 3175T	Gaultheria shallon	Canada	LC311589	LC311591	LC311590	Watanabe et al. (2018)
P. goeppertiae	HJAUP C1919.1T	Goeppertia makoyana	China	PX613556	PX617775	PX625984	This study
P. goeppertiae	HJAUP C1919.2	Goeppertia makoyana	China	PX613557	PX617776	PX625985
P. goeppertiae	HJAUP C1919.3	Goeppertia makoyana	China	PX613558	PX617777	PX625986
P. goeppertiae	HJAUP C1919.4	Goeppertia makoyana	China	PX613559	PX617778	PX625987
P. grevilleae	CBS 114127T	Grevillea sp.	Australia	KM199300	KM199504	KM199407	Maharachchikumbura et al. (2014)
P. guangdongensis	ZHKUCC 22–0016T	Arenga pinnata	China	ON180762	ON221520	ON221548	Xiong et al. (2022)
P. guangdongensis	ZHKUCC 22–0017	Arenga pinnata	China	ON180763	ON221521	ON221549
P. guangdongensis	ZHKUCC 22–0018	Arenga pinnata	China	ON180764	ON221522	ON221550
P. guangxiensis	CFCC 54308T	Quercus griffithii	China	OK339737	OK358498	OK358513	Jiang et al. (2022a)
P. guangxiensis	CFCC 54300	Quercus griffithii	China	OK339738	OK358499	OK358514
P. guiyangensis	CFCC 70626T	Eriobotrya japonica	China	PP784740	PP842629	PP842617	Zhang et al. (2024)
P. guizhouensis	CFCC 54803	Cyclobalanopsis glauca	China	ON007035	ON005052	ON005063	Jiang et al. (2022a)
P. guizhouensis	CFCC 57364T	Cyclobalanopsis glauca	China	ON007036	ON005053	ON005064
P. hawaiiensis	CBS 114491T	Leucospermum sp.	USA	KM199339	KM199514	KM199428	Maharachchikumbura et al. (2014)
P. hederae	HJAUP C1638.221T	Hedera helix	China	PP962270	PP952252	PP952234	Luo et al. (2024)
P. hederae	HJAUP C1638.222	Hedera helix	China	PP962271	–	PP952216
P. hispanica	CBS 115391T	Protea sp.	Spain	MH553981	MH554399	MH554640	Liu et al. (2019)
P. hollandica	CBS 265.33T	Sciadopitys verticillata	Netherlands	KM199328	KM199481	KM199388	Maharachchikumbura et al. (2014)
P. hollandica	MEAN 1091	Pinus pinea	Portugal	MT374678	MT374691	MT374703	Silva et al. (2020)
P. humicola	CBS 336.97T	Soil	Papua New Guinea	KM199317	KM199484	KM199420	Maharachchikumbura et al. (2014)
P. hunanensis	CSUFTCC15T	Camellia oleifera	China	OK493599	OK507969	OK562374	Li et al. (2021)
P. hunanensis	CSUFTCC18	Camellia oleifera	China	OK493600	OK507970	OK562375
P. hydei	MFLUCC 20–0135T	Litsea petiolata	Thailand	MW266063	MW251113	MW251112	Huanaluek et al. (2021)
P. iberica	CAA 1004T	Pinus radiata	Spain	MW732248	MW759038	MW759035	Monteiro et al. (2022)
P. iberica	CAA 1006	Pinus radiata	Spain	MW732249	MW759039	MW759036
P. inflexa	MFLUCC 12–0270T	Unidentified tree	China	JX399008	JX399072	JX399039	Maharachchikumbura et al. (2012)
P. intermedia	MFLUCC 12–0259T	Unidentified tree	China	JX398993	JX399059	JX399028	Maharachchikumbura et al. (2012)
P. italiana	MFLU 14–0214T	Cupressus glabra	Italy	KP781878	KP781881	KP781882	Liu et al. (2015)
P. jesteri	MFLUCC12–0279	Fagraea bodenii	China	JX399012	JX399076	JX399043	Maharachchikumbura et al. (2012)
P. jiangmenensis	CFCC 72595T	Pinus massoniana	China	PV259810	PV275131	PV275205	Wang et al. (2025)
P. jiangmenensis	CFCC 72596	Pinus massoniana	China	PV259811	PV275132	PV275206
P. jiangsuensis	CFCC 59538	Pinus massoniana	China	OR533577	OR539186	OR539191	Li et al. (2024)
P. jiangsuensis	CFCC 59539	Pinus massoniana	China	OR533578	OR539187	OR539192
P. jiangsuensis	CFCC 59542	Pinus massoniana	China	OR533581	OR539190	OR539195
P. jiangxiensis	LC4399T	Camellia sp.	China	KX895009	KX895227	KX895341	Liu et al. (2017)
P. jinchanghensis	LC6636T	Camellia sinensis	China	KX895028	KX895247	KX895361	Liu et al. (2017)
P. jinchanghensis	LC8190	Camellia sinensis	China	KY464144	KY464154	KY464164
P. kaki	KNU–PT–1804T	Diospyros kaki	Korea	LC552953	LC553555	LC552954	Das et al. (2020)
P. kandelicola	NCYUCC 19–0355T	Kandelia candel	China	MT560723	MT563102	MT563100	Hyde et al. (2020)
P. kenyana	CBS 442.67T	Coffea sp.	Kenya	KM199302	KM199502	KM199395	Maharachchikumbura et al. (2014)
P. kenyana	LC6633	Camellia sinensis	China	KX895027	KX895246	KX895360
P. kenyana	CFCC 54962	Quercus aliena	China	OM746237	OM840009	OM839910	Jiang et al. (2022a)
P. kenyana	CFCC 54805	Cyclobalanopsis glauca	China	OM746253	OM840025	OM839926
P. kenyana	CFCC 55088	Castanopsis fissa	China	OM746254	OM840026	OM839927
P. knightiae	CBS 111963	Knightia sp.	New Zealand	KM199311	KM199495	KM199406	Maharachchikumbura et al. (2014)
P. knightiae	CBS 114138T	Knightia sp.	New Zealand	KM199310	KM199497	KM199408
P. koelreuteriae	HJAUP C2757.1T	Koelreuteria paniculata	China	PX613560	PX617779	PX625988	This study
P. koelreuteriae	HJAUP C2757.2	Koelreuteria paniculata	China	PX613561	PX617780	PX625989
P. krabiensis	MFLUCC 16–0260T	Pandanus sp.	Thailand	MH388360	MH388395	MH412722	Tibpromma et al. (2018)
P. leucadendri	CBS 121417T	Leucadendron sp.	South Africa	MH553987	MH554412	MH554654	Liu et al. (2019)
P. leucospermi	CBS 114489T	Leucospermum	USA	MH553978	MH554396	MH554637	Liu et al. (2019)
P. licualicola	HGUP 4057T	Licuala grandis	China	KC492509	KC481684	KC481683	Geng et al. (2013)
P. lijiangensis	CFCC 50738T	Castanopsis carlesii var. spinulosa	China	KU860520	KU844185	KU844184	Zhou et al. (2018)
P. linearis	MFLUCC 12–0271T	Trachelospermum sp.	China	JX398992	JX399058	JX399027	Maharachchikumbura et al. (2012)
P. linguae	ZHKUCC 22–0159T	Pyrrosia lingua	China	OP094104	OP186110	OP186108	Li et al. (2023)
P. linguae	ZHKUCC 22–0160	Pyrrosia lingua	China	OP094103	OP186109	OP186107
P. lithocarpi	CFCC 55100T	Lithocarpus chiungchungensis	China	OK339742	OK358503	OK358518	Jiang et al. (2022a)
P. lithocarpi	CFCC 55893	Lithocarpus chiungchungensis	China	OK339743	OK358504	OK358519
P. lobata	CGMCC 3.23467T	Lithocarpus glaber	China	OR247976	OR361451	OR381051	Razaghi et al. (2024)
P. lobata	LC15843	Lithocarpus glaber	China	OR247977	OR361452	OR381052
P. loeiana	MFLUCC 22–0123T	Dead leaves	Thailand	OP497988	OP737881	OP713769	Sun et al. (2023)
P. longiappendiculata	LC3013	Camellia sinensis	China	KX894939	KX895156	KX895271	Liu et al. (2017)
P. lushanensis	LC4344T	Camellia sp.	China	KX895005	KX895223	KX895337	Liu et al. (2017)
P. lushanensis	LC8182	Camellia sp.	China	KY464136	KY464146	KY464156
P. lushanensis	LC8183	Camellia sp.	China	KY464137	KY464147	KY464157
P. lushanensis	CFCC 54894	Quercus serrata	China	OM746282	OM840054	OM839955	Jiang et al. (2022b)
P. macadamiae	BRIP 63738bT	Macadamia integrifolia	Australia	KX186588	KX186621	KX186680	Akinsanmi et al. (2017)
P. macadamiae	BRIP 63739b	Macadamia integrifolia	Australia	KX186587	KX186620	KX186679
P. macadamiae	BRIP 637441a	Macadamia integrifolia	Australia	KX186586	KX186619	KX186678
P. machili	CGMCC 3.23511T	Machilus sp.	China	OR248003	OR361478	OR381078	Razaghi et al. (2024)
P. machiliana	HJAUP C1790.221T	Machilus pauhoi	China	PP962355	PP952253	PP952214	Luo et al. (2024)
P. machiliana	HJAUP C1790.222	Machilus pauhoi	China	PP962356	PP952254	PP952215
P. machiliana	HJAUP C1704.221	Rhododendron simsii	China	PP962276	PP952255	PP952211
P. machiliana	HJAUP C1704.222	Rhododendron simsii	China	PP962277	PP952256	PP952212
P. machiliana	HJAUP C1704.223	Rhododendron simsii	China	PP962278	PP952257	PP952213
P. machiliana	HJAUP C2801.1	Bambusa multiplex	China	PX613562	PX617781	PX625990	This study
P. machiliana	HJAUP C2801.2	Bambusa multiplex	China	PX613563	PX617782	PX625991
P. malayana	CBS 102220T	Macaranga triloba	Malaysia	KM199306	KM199482	KM199411	Maharachchikumbura et al. (2014)
P. mangifericola	HJAUP C1639.221T	Mangifera indica	China	PP962272	PP952251	PP952217	Luo et al. (2024)
P. mangifericola	HJAUP C1639.222	Mangifera indica	China	PP962273	PP952250	PP952218
P. manyueyuanensis	NTUPPMCC 18-165T	Ophiocordyceps sp.	China	OR125060	OR126313	OR126306	Hsu et al. (2024)
P. manyueyuanensis	NTUPPMCC 22-012	Ophiocordyceps sp.	China	OR125061	OR126314	OR126307
P. massoniana	CFCC 72593T	Pinus massoniana	China	PV259820	PV275141	PV275215	Wang et al. (2025)
P. massoniana	CFCC 72594	Pinus massoniana	China	PV259821	PV275142	PV275216
P. menhaiensis	YN3A1T	Camellia sinensis	China	KU252272	KU252401	KU252488	Wang et al. (2019)
P. monochaeta	CBS 144.97T	Quercus robur	Netherlands	KM199327	KM199479	KM199386	Maharachchikumbura et al. (2014)
P. monochaeta	CBS 440.83	Taxus baccata	Netherlands	KM199329	KM199480	KM199387
P. multiappendiculata	CGMCC 3.23514T	NA	China	OR248008	OR361483	OR381083	Razaghi et al. (2024)
P. multicolor	CFCC59981T	Taxus chinensis	China	OQ626676	OQ714341	OQ714336	Wang et al. (2024)
P. multicolor	CFCC59982	Taxus chinensis	China	OQ771896	OQ779483	OQ779488
P. nanjingensis	CSUFTCC20	Camellia oleifera	China	OK493603	OK507973	OK562378	Li et al. (2021)
P. nanjingensis	CSUFTCC04	Camellia oleifera	China	OK493604	OK507974	OK562379
P. nanningensis	CSUFTCC10T	Camellia oleifera	China	OK493596	OK507966	OK562371	Li et al. (2021)
P. nanningensis	CSUFTCC11	Camellia oleifera	China	OK493597	OK507967	OK562372
P. nannuoensis	SAUCC232203T	Unknown host	China	OR733504	OR912991	OR863909	Yin et al. (2024)
P. nannuoensis	SAUCC232204	Unknown host	China	OR733503	OR912992	OR863910
P. neglecta	TAP1100T	Quercus myrsinaefolia	Japan	AB482220	LC311600	LC311599	Watanabe et al. (2018)
P. neolitseae	NTUCC 17–011T	Neolitsea villosa	China	MH809383	MH809391	MH809387	Ariyawansa and Hyde (2018)
P. neolitseae	CFCC 54590	Lithocarpus amygdalifolius	China	OK339744	OK358505	OK358520	Jiang et al. (2022a)
P. ningboensis	CFCC 72585T	Pinus elliottii	China	PV259822	PV275143	PV275217	Wang et al. (2025)
P. ningboensis	CFCC 72586	Pinus elliottii	China	PV259823	PV275144	PV275218
P. novae–hollandiae	CBS 130973T	Banksia grandis	Australia	KM199337	KM199511	KM199425	Maharachchikumbura et al. (2014)
P. oryzae	CBS 111522	Telopea sp.	USA	KM199294	KM199493	KM199394	Maharachchikumbura et al. (2014)
P. oryzae	CBS 171.26	NA	Italy	KM199304	KM199494	KM199397
P. oryzae	CBS 353.69T	Oryza sativa	Denmark	KM199299	KM199496	KM199398
P. pallidotheae	MAFF 240993T	Pieris japonica	Japan	AB482220	LC311585	LC311584	Watanabe et al. (2010)
P. pandanicola	MFLUCC 16–0255T	Pandanus sp.	Thailand	MH388361	MH388396	MH412723	Tibpromma et al. (2018)
P. papuana	CBS 331.96T	Coastal soil	Papua New Guinea	KM199321	KM199491	KM199413	Maharachchikumbura et al. (2014)
P. papuana	CBS 887.96	Cocos nucifera	Papua New Guinea	KM199318	KM199492	KM199415
P. parva	CBS 265.37	Delonix regia	NA	KM199312	KM199508	KM199404	Maharachchikumbura et al. (2014)
P. parva	CBS 278.35T	Leucothoe fontanesiana	NA	KM199313	KM199509	KM199405
P. photinicola	GZCC 16–0028T	Photinia serrulata	China	KY092404	KY047662	KY047663	Chen et al. (2017)
P. phyllostachydis	ZHKUCC 23–0873T	NA	China	OR343210	OR367675	OR367676	Zhao et al. (2024)
P. pini	MEAN 1092T	Pinus pinea	Portugal	MT374680	MT374693	MT374705	Silva et al. (2020)
P. pinicola	KUMCC 19–0183T	Pinus armandii	China	MN412636	MN417509	MN417507	Tibpromma et al. (2019)
P. piraubensis	COAD 2165T	Psidium guajava	Brazil	MH627381	MH643774	MH643773	Jayawardena et al. (2022)
P. portugallica	CBS 393.48T	NA	Portugal	KM199335	KM199510	KM199422	Maharachchikumbura et al. (2014)
P. portugallica	CBS 684.85	Camellia japonica	New Zealand	MH554065	MH554501	MH554741	Liu et al. (2019)
P. pruni	CGMCC 3.23507T	Prunus cerasoides	China	OR248001	OR361476	OR381076	Razaghi et al. (2024)
P. pruni	LC15860	Prunus cerasoides	China	OR248002	OR361477	OR381077
P. rhaphiolepis	SAUCC367701T	Rhaphiolepis indica	China	OR733502	OR912994	OR863906	Yin et al. (2024)
P. rhaphiolepis	SAUCC367702	Rhaphiolepis indica	China	OR733501	OR912995	OR863907
P. rhizophorae	MFLUCC 17–0416T	Rhizophora mucronata	Thailand	MK764283	MK764327	MK764349	Norphanphoun et al. (2019)
P. rhizophorae	MFLUCC 17–0417	Rhizophora mucronata	Thailand	MK764284	MK764328	MK764350
P. rhododendri	IFRDCC 2399T	Rhododendron sinogrande	China	KC537804	KC537811	KC537818	Norphanphoun et al. (2019)
P. rhodomyrtus	CFCC 54733	Quercus aliena	China	OM746310	OM840082	OM839983	Jiang et al. (2022b)
P. rhodomyrtus	CFCC 55052	Cyclobalanopsis augustinii	China	OM746311	OM840083	OM839984
P. rosarioides	CGMCC 3.23549T	Rhododendron decorum	China	OP082430	OP185513	OP185520	Gu et al. (2022)
P. rosea	MFLUCC 12–0258T	Pinus sp.	China	JX399005	JX399069	JX399036	Maharachchikumbura et al. (2012)
P. rubrae	CGMCC 3.23499T	Quercus rubra	China	OR247997	OR361472	OR381072	Razaghi et al. (2024)
P. rubrae	LC8233	Plagiogyria glauca	China	OR248000	OR361475	OR381075
P. sabal	ZHKUCC 22–0027	Sabal mexicana	China	ON180765	ON221523	ON221551	Xiong et al. (2022)
P. sabal	ZHKUCC 22–0029	Sabal mexicana	China	ON180767	ON221525	ON221553
P. schisandrae	CFCC 59550T	Schisandra sphenanthera	China	OR775411	OR766002	OR766014	Yuan et al. (2024)
P. schisandrae	CFCC 59551	Schisandra sphenanthera	China	OR775412	OR766003	OR766015
P. scoparia	CBS 176.25T	Chamaecyparis sp.	China	KM199330	KM199478	KM199393	Maharachchikumbura et al. (2012)
P. sequoiae	MFLUCC 13–0399T	Sequoia sempervirens	Italy	KX572339	–	–	Maharachchikumbura et al. (2012)
P. shaanxiensis	CFCC 54958T	Quercus variabilis	China	ON007026	ON005043	ON005054	Jiang et al. (2022a)
P. shaanxiensis	CFCC 57356	Quercus variabilis	China	ON007027	ON005044	ON005055
P. shanweiensis	CFCC 72591T	Pinus massoniana	China	PV259824	PV275145	PV275219	Wang et al. (2025)
P. shanweiensis	CFCC 72592	Pinus massoniana	China	PV259825	PV275146	PV275220
P. shorea	MFLUCC 12–0314T	Shorea obtusa	Thailand	KJ503811	KJ503817	KJ503814	Song et al. (2014)
P. sichuanensis	SC3A21T	Camellia sinensis	China	KX146689	KX146748	KX146807	Wang et al. (2019)
P. silvicola	CFCC 55296T	Cyclobalanopsis kerrii	China	ON007032	ON005049	ON005060	Jiang et al. (2022a)
P. silvicola	CFCC 54915	Cyclobalanopsis kerrii	China	ON007033	ON005050	ON005061
P. silvicola	CFCC 57363	Cyclobalanopsis kerrii	China	ON007034	ON005051	ON005062
P. smilacicola	MFLUCC 22–0125T	Smilax sp.	Thailand	OP497991	OP753376	OP762673	Sun et al. (2023)
P. solicola	SAUCC003804T	Soil	China	OQ692020	OQ718737	OQ718795	Li et al. (2024)
P. solicola	SAUCC003806	Soil	China	OQ692021	OQ718738	OQ718796
P. solicola	SAUCC003807	Soil	China	OQ692022	OQ718739	OQ718797
P. sonneratiae	CFCC 57392	Sonneratia apetala	China	ON114182	ON086810	ON086814	Jiang et al. (2022c)
P. sonneratiae	CFCC 57394T	Sonneratia apetala	China	ON114184	ON086812	ON086816
P. sonneratiae	CFCC 57395	Sonneratia apetala	China	ON114185	ON086813	ON086817
P. spathulata	CBS 356.86T	Gevuina avellana	Chile	KM199338	KM199513	KM199423	Maharachchikumbura et al. (2014)
P. spathuliappendiculata	CBS 144035T	Phoenix canariensis	Australia	MH554172	MH554607	MH554845	Liu et al. (2019)
P. suae	CGMCC 3.23546T	Rhododendron delavayi	China	OP082428	OP185514	OP185521	Gu et al. (2022)
P. taxicola	CFCC59976T	Taxus chinensis	China	OQ626673	OQ714338	OQ714333	Wang et al. (2024)
P. taxicola	CFCC59978	Taxus chinensis	China	OQ771893	OQ779480	OQ779485
P. telopeae	CBS 114137	Protea sp.	Australia	KM199301	KM199559	KM199469	Maharachchikumbura et al. (2014)
P. telopeae	CBS 114161T	Telopea sp.	Australia	KM199296	KM199500	KM199403
P. telopeae	CBS 113606	Telopea sp.	Australia	KM199295	KM199498	KM199402
P. terricola	CBS 141.69T	Soil	Pacific Islands	MH554004	MH554438	MH554680	Liu et al. (2019)
P. thailandica	MFLUCC 17–1616T	Rhizophora apiculata	Thailand	MK764286	MK764330	MK764352	Maharachchikumbura et al. (2014)
P. thailandica	MFLUCC 17–1617	Rhizophora apiculata	Thailand	MK764285	MK764329	MK764351
P. thunbergii	CFCC 72589T	Pinus thunbergii	China	PV259838	PV275159	PV275233	Wang et al. (2025)
P. thunbergii	CFCC 72590	Pinus thunbergii	China	PV259839	PV275160	PV275234
P. trachycarpicola	OP068T	Trachycarpus fortunei	China	JQ845947	JQ845946	JQ845945	Zhang et al. (2012b)
P. trachycarpicola	OP143	Podocarpus macrophyllus	China	KC537809	KC537816	KC537823
P. trachycarpicola	MFLUCC 12-0267	Unidentified tree	China	JX399001	JX399065	JX399032	Maharachchikumbura et al. (2012)
P. tumida	CFCC 55158T	Rosa chinensis	China	OK560610	OL814524	OM158174	Peng et al. (2022)
P. tumida	CFCC 55159	Rosa chinensis	China	OK560613	OL814527	OM158177
P. unicolor	MFLUCC 12–0276T	Rhododendron sp.	China	JX398999	–	JX399030	Maharachchikumbura et al. (2012)
P. verruculosa	MFLUCC 12–0274T	Rhododendron sp.	China	JX398996	JX399061	–	Maharachchikumbura et al. (2012)
P. wenzhouensis	CFCC 72587T	Pinus massoniana	China	PV259840	PV275161	PV275235	Wang et al. (2025)
P. wenzhouensis	CFCC 72588	Pinus massoniana	China	PV259845	PV275166	PV275240
P. wulichongensis	CGMCC 3.23469T	Poaceae	China	OR247978	OR361453	OR381053	Razaghi et al. (2024)
P. wulichongensis	LC15846	Poaceae	China	OR247979	OR361454	OR381054
P. yanglingensis	LC 4553T	Camellia sinensis	China	KX895012	KX895231	KX895345	Liu et al. (2017)
P. yunnanensis	HMAS 96359T	Podocarpus macrophyllus	China	AY373375	–	–	Wei et al. (2013)
Nonappendiculata quercina	CBS 116061T	Quercus suber	Italy	MH553982	MH554400	MH554641	Liu et al. (2019)
N. quercina	CBS 270.82	Quercus pubescens	Italy	MH554025	MH554459	MH554701

Full text

Introduction

Fungi represent one of the most diverse groups of organisms globally, playing critical roles in areas such as culinary value, ecological regulation, nutrient cycling, and innovative applications in biotechnology, medicine, and ecological conservation (Niego et al. 2023). Projections derived from host-association models estimate global fungal diversity at 2.2 to 3.8 million species, whereas high-throughput sequencing approaches yield substantially higher estimates in the range of 11.7 to 13.2 million species (Hawksworth and Lücking 2017; Hyde 2022). However, only around 200,000 fungal species have been discovered and formally documented in Fungal Names (FN, https://nmdc.cn/fungalnames/).

The genus Pestalotiopsis Steyaert was segregated from Pestalotia De Not. by Steyaert (1949) to accommodate those taxa with 5-celled conidia based on conidial forms, and Pestalotiopsis maculans (Corda) Nag Raj (≡ Sporocadus maculans Corda) was designated as the type species (Nag Raj 1985; Maharachchikumbura et al. 2014; Wijayawardene et al. 2017). Pestalotiopsis species are easily characterized by fusiform or subcylindrical, 5-celled conidia with three pigmented median cells and the presence of apical and basal appendages (Ariyawansa and Hyde 2018; Yin et al. 2024). Maharachchikumbura et al. (2014) further proposed two segregated anamorphic genera from Pestalotiopsis, namely Neopestalotiopsis Maharachch., K.D. Hyde & Crous and Pseudopestalotiopsis Maharachch., K.D. Hyde & Crous, based on combined datasets (ITS, tef1-α, and tub2) and the conidial pigmentation of the three median cells. As a result, Neopestalotiopsis differs from Pestalotiopsis and Pseudopestalotiopsis by its conidia with versicolorous median cells, and Pseudopestalotiopsis can be distinguished from Pestalotiopsis by sequence data and its conidia with dark-colored concolorous median cells. Pestalotiopsis is a species-rich group with varied habitats distributed in tropical and temperate regions (Bate-Smith and Metcalfe 1957; Luo et al. 2024). To date, about 457 epithets of Pestalotiopsis are recorded in Index Fungorum (Index Fungorum 2025). Members of the genus are common phytopathogens causing a variety of plant diseases, also occurring as endophytes and saprophytes isolated from leaf tissues, soil substrates, and rotted leaves, with some species further implicated in human and animal infections (Zhang et al. 2012a; Monden et al. 2013; Li et al. 2024; Luo et al. 2024; Yin et al. 2024). Previous research on Pestalotiopsis across a spectrum of environments has revealed a range of ecological functions. For example, functioning as saprophytes, some species accelerate material decomposition, whereas as endophytes, some species serve as sources of novel compounds with medicinal, agricultural, and industrial relevance (Xu et al. 2010, 2014).

Maharachchikumbura et al. (2014) revised the genus Pestalotiopsis based on combined ITS, tef1-α, and tub2 sequence data and morphological characteristics. These loci demonstrated strong phylogenetic resolution at the genus level and have been widely adopted in subsequent phylogenetic studies (Lin et al. 2023; Sun et al. 2023; Wang et al. 2025). In this study, samples of diseased leaves were collected from southern China. Accordingly, based on morphological observations and phylogenetic analyses (ITS, tef1-α, and tub2), 21 strains were assigned to Pestalotiopsis, including five novel species, namely P. acericola, P. corchorifolii, P. fraseri, P. goeppertiae, and P. koelreuteriae, and one known species, P. machiliana X.X. Luo & Jian Ma. Detailed illustrations and morphological descriptions of these taxa are provided below.

Materials and methods

Sample collection, fungal isolation, and morphological observation

Samples of diseased plant leaves were collected from botanical gardens and forest parks in southern China. The samples were placed in sealed bags with filter paper and transported to the laboratory. Fungi were isolated according to the tissue isolation method described by Gao et al. (2014). Leaf tissues were transferred onto potato dextrose agar (PDA; 200 g potato, 20 g glucose, 20 g agar, and 1000 mL water) plates and cultured at 25 °C under alternating light and dark conditions (8 h/16 h) for seven days, after which cultural characteristics, including color, shape, and size, were observed and recorded. The microscopic structures of isolated fungi were examined using an Olympus BX53 light microscope equipped with an Olympus DP27 digital camera (Olympus Optical Co., Ltd., Tokyo, Japan) to describe their morphological characteristics. All fungal strains were stored in 10% sterilized glycerin at 4 °C for further studies. The studied specimens and cultures were deposited in the Herbarium of Jiangxi Agricultural University, Plant Pathology, Nanchang, China (HJAUP).

DNA extraction, PCR amplification, and sequencing

After fungal cultures were grown at 25 °C under a light–dark cycle (8 h/16 h) for 14 days, fresh mycelia were scraped with a sterile needle and transferred into 2 mL centrifuge tubes for grinding with liquid nitrogen. Genomic DNA was extracted using the Solarbio Fungal Genomic DNA Extraction Kit (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) according to the manufacturer’s protocol. DNA was amplified in a 25 μL PCR system consisting of 12.5 µL of 2 × Power Taq PCR MasterMix, 9.5 µL of double-distilled water (ddH_2_O), 1 µL of DNA template, and 1 µL each of forward and reverse primers, targeting three loci: ITS, tef1-α, and tub2. The primer pairs and PCR programs are listed in Table 1. PCR amplification products were stained with ethidium bromide and examined by electrophoresis in 1% agarose gels. Purification and sequencing of the PCR products were performed by Hunan Youkanglai Biotechnology Co., Ltd. The obtained sequences were submitted to the GenBank database (www.ncbi.nlm.nih.gov, accessed on 1 December 2025; Table 2).

Phylogenetic analyses

According to recent publications (Hsu et al. 2024; Li et al. 2024; Luo et al. 2024; Zhao et al. 2024; Cao et al. 2025; Jiang et al. 2025; Wang et al. 2025), sequences of Pestalotiopsis species obtained from GenBank were selected for phylogenetic analyses together with the 21 strains in this study (Table 2). Nonappendiculata quercina (CBS 116061 and CBS 270.82) was used as the outgroup. All sequences were aligned using MAFFT v.7.526 (Katoh et al. 2019, https://mafft.cbrc.jp/alignment/server/). A combined multilocus sequence dataset comprising ITS, tef1-α, and tub2 was assembled and manually optimized to improve alignment and sequence accuracy using PhyloSuite v.1.2.2 (Zhang et al. 2020). Phylogenetic trees were constructed based on the concatenated dataset using maximum likelihood (ML) and Bayesian inference (BI) in PhyloSuite v.1.2.2 (Zhang et al. 2020). The optimal partition model (edge-linked) was selected using the ModelFinder function (Kalyaanamoorthy et al. 2017), with the BIC criterion applied for IQ-TREE construction and the AICc criterion implemented for MrBayes analysis. Maximum likelihood phylogenies were constructed using IQ-TREE (Nguyen et al. 2015) under an edge-linked partition model, with nodal support assessed through 10,000 ultrafast bootstrap replicates (Minh et al. 2013). The final phylogenetic tree was selected from suboptimal trees of each run through likelihood score comparison, with the following models applied to respective gene partitions: HKY+F+R5 for ITS, TIM2e+R4 for tef1-α, and TPM2u+F+I+G4 for tub2. Bayesian inference phylogenies were constructed using MrBayes v.3.2.6 (Ronquist et al. 2012) under a partition model configuration, with two parallel runs and 2,000,000 generations, while discarding the initial 25% of sampled data as burn-in. The best-fit models were HKY+F+I+G4 for ITS, GTR+F+G4 for tef1-α, and GTR+F+I+G4 for tub2. Phylogenetic trees were visualized using FigTree v.1.4.4 (http://tree.bio.ed.ac.uk/software/figtree), with subsequent editing and layout finalized in Adobe Illustrator CS v.5.

Results

Molecular phylogeny

Based on the concatenated sequences of the three barcode genes (ITS, tef1-α, and tub2), the phylogenetic tree (Fig. 1) was constructed using maximum likelihood (ML) and Bayesian inference (BI) to analyze the phylogenetic relationships of the 21 strains within the genus Pestalotiopsis. The phylogenetic analyses included 301 strains (Table 1), comprising 159 accepted Pestalotiopsis species and 21 strains from this study, with Nonappendiculata quercina (CBS 116061 and CBS 270.82) serving as the outgroup. The combined sequence consisted of 1472 nucleotide positions (ITS: 1–556, tef1-α: 557–1013, tub2: 1014–1472), comprising 901 distinct patterns, 662 parsimony-informative sites, 163 singleton sites, and 647 constant sites. Phylogenetic trees were constructed based on the concatenated sequences using ML and BI methods with essentially identical topological architectures. The optimal ML phylogenetic tree (lnL = −19450.797) is shown in Fig. 1, with node support values annotated adjacent to each branch. At each node, the first and second numerical descriptors correspond to ultrafast bootstrap support values from ML and posterior probabilities obtained from BI, respectively.

A maximum-likelihood phylogenetic tree of Pestalotiopsis constructed based on concatenated sequence data of ITS, tef1-α, and tub2. Bootstrap support values for ML greater than 80% and Bayesian posterior probabilities greater than 0.95 are shown near the nodes. The tree is rooted with Nonappendiculata quercina (CBS 116061 and CBS 270.82). New strains identified in this study are shown in blue; new species are shown in red. Some branches were shortened according to the indicated multipliers, and these are indicated by the symbol (//).

Taxonomy

Pestalotiopsis

acericola

Taxon classificationFungiAmphisphaerialesPestalotiopsidaceae

M.G. Liao & Jian Ma sp. nov.

7D2EAFC3-3BC4-575C-A1F2-7CE493E1F903

Index Fungorum: IF904707

Fig. 2

Type.

China • Zhejiang Province, Hangzhou City, West Lake Scenic Area, on diseased leaves of Acer buergerianum, 22 October 2023, X.X. Luo (HJAUP M1856, holotype), ex-type living culture, HJAUP C1856.1 = HJAUP C1856.2 = HJAUP C1856.3 = HJAUP C1856.4.

Etymology.

Named after the genus, Acer, from which the fungus was isolated.

Description.

Regular leaf spots, grey white in center with blurred margin. Asexual morph on PDA: Conidiomata acervular, globose to clavate, 350–660 μm diam., superficial, solitary or aggregated in clusters, black. Conidiophores indistinct and reduced to conidiogenous cells. Conidiogenous cells hyaline, smooth, cylindrical to ampulliform. Conidia fusiform, straight or slightly curved, 16.1–24.5 × 5.2–6.9 μm (x̄ = 20.9 × 5.9 μm, n = 50), 4-septate, slightly constricted at the septa; basal cell conical, 3.1–5.3 μm (x̄ = 4.1 μm), hyaline or sometimes pale brown, smooth, thin-walled, with a single filiform appendage, unbranched, 4.6–10.7 μm (x̄ = 7.0 μm) long; three median cells doliiform to cylindrical, smooth, thick-walled, 10.4–14.6 μm (x̄ = 12.8 μm), concolorous, pale brown to brown, somewhat constricted at the septa, second cell from the base 3.6–5.0 µm (x̄ = 4.4 μm) long, third cell 3.0–5.0 µm (x̄ = 4.1 μm) long, fourth cell 3.6–5.8 µm (x̄ = 4.6 μm) long); apical cell conical to acute, hyaline, smooth, thin-walled, 2.6–4.6 µm (x̄ = 3.9 μm) long, with 2–3 filiform appendages, arising from the apex of the apical cell each at a different point, unbranched, 12.3–27.5 µm (x̄ = 17.7 μm) long. Sexual morph: not observed.

Pestalotiopsis acericola (HJAUP C1856.1, ex-type). a, b. Leaf of host plant (front and reverse); c, d. Culture on PDA (front and reverse); e, f. Conidiomata; g, h. Conidiogenous cells and conidia; i–p. Conidia. Scale bars: 400 µm (e, f); 20 µm (g, h); 10 µm (i–p).

Culture characteristics.

Colonies on PDA grow fast, filamentous, reaching 76–82 mm diam. after 5–7 days at 25 °C in light and dark conditions (8 h/16 h), white, with flocculent mycelium and entire edge, forming black, brown conidiomata, and reverse pale orange in center.

Note.

Phylogenetic analyses revealed that the four strains (HJAUP C1856.1^T^, HJAUP C1856.2, HJAUP C1856.3, and HJAUP C1856.4) of P. acericola form a distinct clade sister to P. ficicrescens (HGUP 861^T^ and CGMCC 3.23471) with 98% ML/1.00 BI bootstrap support (Fig. 1). Based on a BLASTn search of P. acericola (HJAUP C1856.1^T^) and P. ficicrescens (HGUP 861^T^) in GenBank, comparisons of nucleotides showed 2 bp (537/539, including two gaps), 1 bp (291/292, no gaps), and 4 bp (451/455, including one gap) nucleotide differences in the ITS, tef1-α, and tub2 regions, respectively. Moreover, P. acericola differs from P. ficicrescens Qi Yang & Yong Wang bis (Hyde et al. 2023) in its smaller conidiomata (350–660 μm diam. vs. 400–1200 μm diam.) and wider conidia (5.2–6.9 μm vs. 3–5.5 μm) with a longer fourth cell (3.6–5.8 µm vs. 3–5 µm) from the base, a longer basal appendage (4.6–10.7 μm vs. 3.5–7 µm), and longer apical appendages (12.3–27.5 μm vs. 10.5–18 µm). Furthermore, P. acericola can be distinguished from P. ficicrescens by its different host (Acer buergerianum vs. Ficus tikoua).

Pestalotiopsis

corchorifolii

Taxon classificationFungiAmphisphaerialesPestalotiopsidaceae

M.G. Liao & Jian Ma sp. nov.

AA172086-4AAB-5E13-A437-236403FC8465

861554

Fig. 3

Type.

China • Zhejiang Province, Wenzhou City, Wenzhou Botanical Garden, on diseased leaves of Rubus corchorifolius, 24 October 2023, X.X. Luo (HJAUP M1891, holotype), ex-type living culture HJAUP C1891.1 = HJAUP C1891.2 = HJAUP C1891.3 = HJAUP C1891.4 = HJAUP M1891.5.

Etymology.

Named after the host species, Rubus corchorifolius, from which the fungus was isolated.

Description.

Regular leaf spots, grey white in center with brown at margin. Asexual morph on PDA: Conidiomata acervular, globose to clavate, 849–1375 μm diam., solitary or aggregated in clusters, black. Conidiophores indistinct and reduced to conidiogenous cells. Conidiogenous cells hyaline, smooth, cylindrical to ampulliform. Conidia fusiform, straight or slightly curved, 14.6–21.6 × 4.4–5.9 μm (x̄ = 17.4 × 5.3 μm, n = 50), 4-septate, slightly constricted at the septa; basal cell conical, 2.2–3.9 μm (x̄ = 2.6 μm), hyaline, smooth, thin-walled, with a single filiform appendage, unbranched, 0.9–3.1 μm (x̄ = 2.1 μm) long; three median cells doliiform to cylindrical, smooth, thick-walled, 10.5–14.0 μm (x̄ = 12.1 μm), concolorous, brown, somewhat constricted at the septa, second cell from the base 3.4–5.6 µm (x̄ = 4.1 μm) long, third cell 3.3–4.6 µm (x̄ = 4.1 μm) long, fourth cell 3.4–4.7 µm (x̄ = 4.0 μm) long); apical cell conical to acute, hyaline, smooth, thin-walled, 1.9–3.7 µm (x̄ = 2.7 μm) long, with 2–3 filiform appendages, arising from the apex of the apical cell each at a different point, unbranched, 6.7–17.4 µm (x̄ = 11.5 μm) long. Sexual morph: not observed.

Pestalotiopsis corchorifolii (HJAUP C1891.1, ex-type). a, b. Leaf of host plant (front and reverse); c, d. Culture on PDA (front and reverse); e, f. Conidiomata; g, h. Conidiogenous cells and conidia; i–p. Conidia. Scale bars: 200 µm (e, f); 10 µm (g–p).

Culture characteristics.

Colonies on PDA grow fast, filamentous, reaching 85–90 mm diam. after 5–7 days at 25 °C in light and dark conditions (8 h/16 h), white, with flocculent mycelium and entire edge, forming black conidiomata, and reverse white.

Note.

Phylogenetic analyses revealed that the five strains (HJAUP C1891.1^T^, HJAUP C1891.2, HJAUP C1891.3, HJAUP C1891.4, and HJAUP M1891.5) of P. corchorifolii form a distinct clade sister to P. camelliicola (HJAUP C1804.221^T^ and HJAUP C1804.222) with 98% ML/1.00 BI bootstrap support (Fig. 1). Based on a BLASTn search of P. corchorifolii (HJAUP C1891.1^T^) and P. camelliicola (HJAUP C1804.221^T^) in GenBank, comparisons of nucleotides showed 1 bp (630/631, including one gap), 5 bp (296/301, including three gaps), and 5 bp (476/481, including one gap) nucleotide differences in the ITS, tef1-α, and tub2 regions, respectively. Moreover, P. corchorifolii can be distinguished from P. camelliicola X.X. Luo & Jian Ma (Luo et al. 2024) by its larger conidiomata (849–1375 μm diam. vs. 470–1320 μm diam.) and smooth, narrower conidia (4.4–5.9 μm vs. 5.7–7.6 μm), and further differs in that the conidia of P. camelliicola have 2–4 tubular apical appendages arising from an apical crest or irregularly branched along their length, resulting in 2–3 branches. Furthermore, P. corchorifolii can be distinguished from P. camelliicola by its different host (Rubus corchorifolius vs. Camellia japonica).

Pestalotiopsis

fraseri

Taxon classificationFungiAmphisphaerialesPestalotiopsidaceae

M.G. Liao & Jian Ma sp. nov.

A3BC8BEE-4D82-5832-AE7F-6DD8C75996A6

861555

Fig. 4

Type.

China • Jiangxi Province, Nanchang City, Jiangxi Agricultural University, on diseased leaves of Photinia × fraseri Dress, 26 October 2023, X.X. Luo (HJAUP M1693, holotype), ex-type living culture HJAUP C1693.1 = HJAUP C1693.2 = HJAUP C1693.3 = HJAUP C1693.4.

Etymology.

Named after the host species, Photinia × fraseri, from which the fungus was isolated.

Description.

Regular leaf spots, pale brown in center with brown at margin. Asexual morph on PDA: Conidiomata acervular, globose to clavate, 426–786 μm diam., solitary, black. Conidiophores indistinct and reduced to conidiogenous cells. Conidiogenous cells hyaline, smooth, cylindrical to ampulliform. Conidia fusiform, straight or slightly curved, 19.3–26.4 × 5.2–6.3 μm (x̄ = 23.0 × 5.7 μm, n = 50), 4-septate, slightly constricted at the septa; basal cell conical, 3.4–5.3 μm (x̄ = 4.4 μm), hyaline, smooth, thin-walled, with a single filiform appendage, unbranched, 4.6–10.5 μm (x̄ = 7.9 μm) long; three median cells doliiform to cylindrical, smooth, thick-walled, 12.2–16.2 μm (x̄ = 14.4 μm), concolorous, brown, somewhat constricted at the septa, second cell from the base 3.9–6.1 µm (x̄ = 4.8 μm) long, third cell 4.0–5.4 µm (x̄ = 4.7 μm) long, fourth cell 4.0–5.2 µm (x̄ = 4.7 μm) long); apical cell conical to acute, hyaline, smooth, thin-walled, 3.7–5.0 µm (x̄ = 4.2 μm) long, with 2–3 filiform appendages, arising from the apex of the apical cell each at a different point, unbranched, 12.3–20.8 µm (x̄ = 16.3 μm) long. Sexual morph: not observed.

Pestalotiopsis fraseri (HJAUP C1693.1, ex-type). a, b. Leaf of host plant (front and reverse); c, d. Culture on PDA (front and reverse); e, f. Conidiomata; g–i. Conidiogenous cells and conidia; j–q. Conidia. Scale bars: 200 µm (e, f); 10 µm (g–q).

Culture characteristics.

Colonies on PDA grow fast, filamentous, reaching 85–90 mm diam. after 5–7 days at 25 °C in light and dark conditions (8 h/16 h), white, with flocculent mycelium and entire edge, forming black conidiomata, and reverse white.

Note.

Phylogenetic analyses revealed that the four strains (HJAUP C1693.1^T^, HJAUP C1693.2, HJAUP C1693.3, and HJAUP C1693.4) of P. fraseri form a distinct clade sister to P. koelreuteriae (HJAUP C2757.1^T^ and HJAUP C2757.2) with 100% ML/1.00 BI bootstrap support (Fig. 1). Based on a BLASTn search of P. fraseri (HJAUP C1693.1^T^) and P. koelreuteriae (HJAUP C2757.1^T^) in GenBank, comparisons of nucleotides showed 13 bp (619/632, including three gaps), 1 bp (296/297, no gaps), and 3 bp (479/482, including one gap) nucleotide differences in the ITS, tef1-α, and tub2 regions, respectively. Based on a BLASTn search of P. fraseri (HJAUP C1693.1^T^) and P. trachycarpicola (OP068^T^) in GenBank, comparisons of nucleotides showed 10 bp (530/540, including one gap) and 1 bp (294/295, no gaps) in the ITS and tef1-α regions, respectively. Moreover, P. fraseri differs from P. koelreuteriae (this study) in its conidia with longer basal appendages (4.6–10.5 μm vs. 3.4–6.7 μm) and longer apical appendages (12.3–20.8 µm vs. 8.1–18.5 µm), and from P. trachycarpicola Yan M. Zhang & K.D. Hyde (Zhang et al. 2012b) in its longer basal appendages (4.6–10.5 μm vs. 2.7–5.5 μm). Furthermore, P. fraseri can be distinguished from P. koelreuteriae and P. trachycarpicola by its different host (Photinia × fraseri vs. Koelreuteria paniculata vs. Trachycarpus fortunei).

Pestalotiopsis

goeppertiae

Taxon classificationFungiAmphisphaerialesPestalotiopsidaceae

M.G. Liao & Jian Ma sp. nov.

CF296B09-00B2-5B7A-BE1A-CE5610216FC1

861556

Fig. 5

Type.

China • Fujian Province, Fuzhou City, Fuzhou Botanical Garden, on diseased leaves of Goeppertia makoyana, 24 October 2023, X.X. Luo (HJAUP M1919, holotype), ex-type living culture HJAUP C1919.1 = HJAUP C1919.2 = HJAUP C1919.3 = HJAUP C1919.4.

Etymology.

Named after the genus, Goeppertia, from which the fungus was isolated.

Description.

Regular leaf spots, grey white in center with brown at margin. Asexual morph on PDA: Conidiomata acervular, globose to clavate, 550–1520 μm diam., superficial, solitary or aggregated in clusters, dark brown. Conidiophores indistinct and reduced to conidiogenous cells. Conidiogenous cells hyaline, smooth, cylindrical to ampulliform. Conidia fusiform, straight or slightly curved, 17.0–23.6 × 5.0–5.9 μm (x̄ = 19.5 × 5.5 μm, n = 50), 4-septate, slightly constricted at the septa; basal cell conical, 2.8–4.5 μm (x̄ = 3.5 μm), hyaline or sometimes pale brown, smooth, thin-walled, with a single filiform appendage, unbranched, 2.3–6.0 μm (x̄ = 3.5 μm) long; three median cells doliiform to cylindrical, smooth, thick-walled, 11.0–14.5 μm (x̄ = 12.4 μm), concolorous, pale brown to brown, somewhat constricted at the septa, second cell from the base 3.4–5.1 µm (x̄ = 4.2 μm) long, third cell 3.7–4.6 µm (x̄ = 4.2 μm) long, fourth cell 3.7–4.9 µm (x̄ = 4.2 μm) long); apical cell conical to acute, hyaline, smooth, thin-walled, 3.2–4.1 µm (x̄ = 3.7 μm) long, with 2–3 filiform appendages, arising from the apex of the apical cell each at a different point, unbranched, 12.6–21.3 µm (x̄ = 15.4 μm) long. Sexual morph: not observed.

Pestalotiopsis goeppertiae (HJAUP C1919.1, ex-type). a, b. Leaf of host plant (front and reverse); c, d. Culture on PDA (front and reverse); e, f. Conidiomata; g–i. Conidiogenous cells and conidia; j–q. Conidia. Scale bars: 200 µm (e, f); 20 µm (g–i); 10 µm (j–q).

Culture characteristics.

Colonies on PDA grow fast, filamentous, reaching 85–90 mm diam. after 5–7 days at 25 °C in light and dark conditions (8 h/16 h), white, with flocculent mycelium and entire edge, forming black, brown conidiomata, and reverse pale orange.

Note.

Phylogenetic analyses revealed that the four strains (HJAUP C1919.1^T^, HJAUP C1919.2, HJAUP C1919.3, and HJAUP C1919.4) of P. goeppertiae form a distinct clade sister to P. neolitseae (NTUCC 17–011^T^ and CFCC 54590) with 97% ML/0.96 BI bootstrap support (Fig. 1). Based on a BLASTn search of P. goeppertiae (HJAUP C1919.1^T^) and P. neolitseae (NTUCC 17–011^T^) in GenBank, comparisons of nucleotides showed 9 bp (248/257, including four gaps) and 1 bp (399/400, no gaps) nucleotide differences in the tef1-α and tub2 regions, respectively. Moreover, P. goeppertiae differs from P. neolitseae H.A. Ariy. & K.D. Hyde (Ariyawansa and Hyde 2018) in its conidia with a shorter fourth cell (3.7–4.9 µm vs. 4–5(–6) µm) from the base and longer apical appendages (12.6–21.3 µm vs. (7–)10–15(–17) μm). Furthermore, P. goeppertiae can be distinguished from P. neolitseae by its different host (Goeppertia makoyana vs. Neolitsea villosa).

Pestalotiopsis

koelreuteriae

Taxon classificationFungiAmphisphaerialesPestalotiopsidaceae

M.G. Liao & Jian Ma sp. nov.

DF7962FF-410E-5E7A-9B5D-2F6BF761096F

861557

Fig. 6

Type.

China • Hunan Province, Zhangjiajie City, Zhangjiajie National Forest Park, on diseased leaves of Koelreuteria paniculata, 18 October 2024, M.G. Liao (HJAUP M2757, holotype), ex-type living culture HJAUP C2757.1 = HJAUP C2757.2.

Etymology.

Named after the genus, Koelreuteria, from which the fungus was isolated.

Description.

Irregular leaf spots, pale brown in center with brown at margin. Asexual morph on PDA: Conidiomata acervular, globose to clavate, 610–750 μm diam., solitary or aggregated in clusters, black. Conidiophores indistinct and reduced to conidiogenous cells. Conidiogenous cells hyaline, smooth, cylindrical to ampulliform. Conidia fusiform, straight or slightly curved, 18.3–26.9 × 4.1–6.0 μm (x̄ = 22.7 × 5.3 μm, n = 50), 4-septate, slightly constricted at the septa; basal cell conical, 2.7–4.6 μm (x̄ = 3.9 μm), hyaline or sometimes pale brown, smooth, thin-walled, with a single filiform appendage, unbranched, 3.4–6.7 μm (x̄ = 4.9 μm) long; three median cells doliiform to cylindrical, smooth, thick-walled, 12.8–17.3 μm (x̄ = 15.2 μm), concolorous, brown, somewhat constricted at the septa, second cell from the base 3.4–6.6 µm (x̄ = 4.8 μm) long, third cell 3.4–6.5 µm (x̄ = 5.3 μm) long, fourth cell 3.8–6.6 µm (x̄ = 5.2 μm) long); apical cell conical to acute, hyaline, smooth, thin-walled, 2.5–5.1 µm (x̄ = 3.5 μm) long, with 1–3 (mostly 2) filiform appendages, arising from the apex of the apical cell each at a different point, unbranched, 8.1–18.5 µm (x̄ = 13.2 μm) long. Sexual morph: not observed.

Pestalotiopsis koelreuteriae (HJAUP C2757.1, ex-type). a, b. Leaf of host plant (front and reverse); c, d. Culture on PDA (front and reverse); e. Conidiomata; f. Conidiogenous cells and conidia; g–p. Conidia. Scale bars: 200 µm (e); 10 µm (f–p).

Culture characteristics.

Colonies on PDA grow fast, filamentous, reaching 50–60 mm diam. after 5–7 days at 25 °C in light and dark conditions (8 h/16 h), white, with flocculent mycelium and entire edge, forming black conidiomata, and reverse pale orange.

Note.

Phylogenetic analyses revealed that the two strains (HJAUP C2757.1^T^ and HJAUP C2757.2) of P. koelreuteriae form a distinct clade sister to P. fraseri (HJAUP C1693.1^T^, HJAUP C1693.2, HJAUP C1693.3, and HJAUP C1693.4) with 100% ML/1.00 BI bootstrap support (Fig. 1). The nucleotide divergences and morphological differentiations between P. koelreuteriae and P. fraseri have been delineated in the preceding section. Comparisons of nucleotides showed 13 bp (2.1%, including three gaps) in the ITS region. Based on the criteria established by Jeewon and Hyde (2016), a divergence of more than 1.5% in the ITS nucleotide sequence can support the recognition of a novel species. Thus, P. koelreuteriae was proposed as a new species.

Pestalotiopsis

machiliana

Taxon classificationFungiAmphisphaerialesPestalotiopsidaceae

X.X. Luo & Jian Ma, Mycokeys 109: 229 (2024)

DC673386-6F04-529D-AE51-5556306EEC4B

Index Fungorum: IF902325

Fig. 7

Type.

China • Hubei Province, Wuhan City, Wuhan Botanical Garden, on diseased leaves of Bambusa multiplex (Lour.) Raeusch. ex Schult. cv. Fernleaf R. A. Young, 24 October 2024, M.G. Liao (HJAUP M2801, living culture HJAUP C2801.1 = HJAUP C2801.2).

Description.

Leaf tip lesions, paler brown spots with brown margin between diseased and healthy tissue. Asexual morph on PDA: Conidiomata acervular, globose to clavate, 1000–1350 μm diam., solitary or aggregated in clusters, black. Conidiophores indistinct and reduced to conidiogenous cells. Conidiogenous cells hyaline, smooth, cylindrical to ampulliform. Conidia fusiform, straight or slightly curved, 18.1–25.1 × 4.9–6.8 μm (x̄ = 21.3 × 5.8 μm, n = 50), 4-septate, slightly constricted at the septa; basal cell conical, 2.9–5.3 μm (x̄ = 3.9 μm), hyaline or sometimes pale brown, smooth, thin-walled, with a single filiform appendage, unbranched, 4.4–7.1 μm (x̄ = 5.9 μm) long; three median cells doliiform to cylindrical, smooth, thick-walled, 11.2–17.3 μm (x̄ = 13.9 μm), concolorous, brown, somewhat constricted at the septa, second cell from the base 3.5–5.7 µm (x̄ = 4.6 μm) long, third cell 3.9–5.9 µm (x̄ = 4.7 μm) long, fourth cell 3.8–5.7 µm (x̄ = 4.6 μm) long); apical cell conical to acute, hyaline, smooth, thin-walled, 2.3–4.8 µm (x̄ = 3.5 μm) long, with 2–3 filiform appendages, arising from the apex of the apical cell each at a different point, unbranched, 9.3–20.8 µm (x̄ = 14.9 μm) long. Sexual morph: not observed.

Pestalotiopsis machiliana (HJAUP C2801.1). a, b. Leaf of host plant (front and reverse); c, d. Culture on PDA (front and reverse); e–f. Conidiomata; g. Conidiogenous cells and conidia; h–o. Conidia. Scale bars: 200 µm (e, f); 10 µm (g–o).

Culture characteristics.

Colonies on PDA grow fast, filamentous, reaching 55–70 mm diam. after 5–7 days at 25 °C in light and dark conditions (8 h /16 h), white, with flocculent mycelium and entire edge, forming black conidiomata, and reverse pale orange.

Notes.

Pestalotiopsis machiliana was introduced by Luo et al. (2024) and isolated from diseased leaves of Machilus pauhoi in Jiangxi Province, China. Phylogenetic analyses showed that our new isolates (HJAUP C2801.1 and HJAUP C2801.2) cluster with the group of P. machiliana (HJAUP C1704.221, HJAUP C1704.222, HJAUP C1704.223, HJAUP C1790.221^T^, and HJAUP C1790.222) with 99% ML/1.00 BI bootstrap support (Fig. 1). A BLASTn search of GenBank revealed that the sequences of our new isolate (HJAUP C2801.1) and P. machiliana (HJAUP C1790.221^T^) share 99% similarity (630/632, including one gap) in ITS, 100% similarity (272/272, no gaps) in tef1-α, and 99% similarity (481/482, including one gap) in tub2. Morphologically, our isolate aligns well with the original description of P. machiliana (Luo et al. 2024). Thus, based on the high morphological similarity and only minor molecular differences, we identified our new isolate as P. machiliana.

Discussion

Morphological characteristics have consistently served as a fundamental criterion for the identification of Pestalotiopsis species. However, with the continuous increase in the number of Pestalotiopsis species, the criteria used for species identification have become increasingly ambiguous (Huanaluek et al. 2021). Maharachchikumbura et al. (2014) previously suggested that continued reliance on conidial size for species delineation within Pestalotiopsis is methodologically unsound. In this study, no significant differences were observed in conidial size between P. acericola and P. chiangmaiensis Y.R. Sun & Yong Wang bis (16.1–24.5 × 5.2–6.9 µm vs. 16–26 × 4–7 µm; Sun et al. 2023), but the two species were clustered into different branches, and the nucleotide differences between P. acericola (HJAUP C1856.1^T^) and P. chiangmaiensis (MFLUCC 22–0127^T^) showed 0.8% (560/565, one gap) in ITS, 7.4% (250/270, eight gaps) in tef1-α, and 3.5% (440/456, one gap) in tub2. Sun et al. (2023) proposed that the individual cell length characteristics of the three median cells should not be considered criteria for interspecific differentiation, as individual cell length measurements duplicate the description of the total length of the three median cells. Therefore, it was suggested that individual cell length measurements be removed from morphological descriptions to achieve simplification. Additionally, based on phylogenetic analyses, P. exudata P. Razaghi, F. Liu & L. Cai and P. multiappendiculata P. Razaghi, F. Liu & L. Cai were proposed as novel species (Razaghi et al. 2024), but their conidial septation (4–5-septate) is inconsistent with the generally accepted morphological concept of 5-celled conidia for Pestalotiopsis species. Although phylogenetic analyses together with morphology currently serve as an effective approach for identifying Pestalotiopsis species, ambiguous morphological concepts can render the classification of these taxa questionable.

To date, 457 species of Pestalotiopsis have been recorded in Index Fungorum (Index Fungorum 2025), but molecular data are available in GenBank for only 159 species. The absence of molecular data precludes the resolution of interspecific relationships through phylogenetic analyses and results in substantial ambiguity in the taxonomic placement of morphologically congruent species within the genus. Maharachchikumbura et al. (2012) tested 10 gene regions (ACT, tub2, CAL, GPDH, GS, ITS, LSU, RPB1, SSU, and tef1-α) to resolve cryptic Pestalotiopsis species and ultimately selected ITS, tef1-α, and tub2 as the most effective molecular markers. However, recent phylogenetic analyses based on these three markers revealed that some species, such as P. verruculosa (MFLUCC 12–0274), lacking tub2, and P. chinensis (MFLUCC 12–0273), P. sequoiae (MFLUCC 13–0399), and P. yunnanensis (HMAS 96359), lacking tub2 and tef1-α, showed low support values (Hsu et al. 2024; Li et al. 2024; Yin et al. 2024). The low support values for these taxa may be attributed to the absence of tef1-α and/or tub2 sequence data, which likely resulted in insufficient phylogenetic information. Thus, completing the ITS, tef1-α, and tub2 sequence information for Pestalotiopsis species is crucial for enabling a more robust discussion of their taxonomic status through phylogenetic analyses. Considering this issue, we conducted phylogenetic analyses using ITS, tef1-α, and tub2 sequences, and our newly obtained 21 strains nested within the genus Pestalotiopsis formed six independent lineages with reliable support values and can be proposed as five new phylogenetic species, namely P. acericola, P. corchorifolii, P. fraseri, P. goeppertiae, and P. koelreuteriae, and one known species, P. machiliana.

Appendages are often used as an important basis for the morphological identification of Pestalotiopsis species, but studies have confirmed their critical roles in conidial dispersal and host colonization (Nag Raj 1993; Gareth Jones 2006; Crous et al. 2012). This facilitates the widespread colonization of various plants by Pestalotiopsis as endophytes and pathogens, thereby enhancing host diversity and competitiveness for ecological niches. Pestalotiopsis causes diseases on a variety of host plants as a pathogen, including tea, ericaceous plants, grapes, pomegranates, blueberries, and other crops, resulting in significant economic losses (Horikawa 1986; Xu et al. 1999; McQuilken and Hopkins 2004; Keith et al. 2006; Espinoza et al. 2008; Joshi et al. 2009). Many Pestalotiopsis species, when living as endophytes, have been demonstrated to produce numerous secondary metabolites with diverse structural characteristics (Xu et al. 2010), and previous studies have reported over 160 different compounds isolated from Pestalotiopsis species, which demonstrate significant potential in antifungal and antimicrobial activities and compound synthesis (Xu et al. 2014). Thus, further research is necessary to contribute to the fields of plant pathology and fungal taxonomy and to explore their functional roles.

Supplementary Material

XML Treatment for Pestalotiopsis acericola

XML Treatment for Pestalotiopsis corchorifolii

XML Treatment for Pestalotiopsis fraseri

XML Treatment for Pestalotiopsis goeppertiae

XML Treatment for Pestalotiopsis koelreuteriae

XML Treatment for Pestalotiopsis machiliana