Bandavirus dabieense Isolated From a Wild Leopard Cat (Prionailurus bengalensis euptilura) in the Republic of Korea
Hye-Ryung Byun, Su-Jin Chae, Seong-Ryeong Ji, Hak Sub Shin, Jun-Gu Kang, Hyesung Jeong, Suwoong Lee, Joon-Seok Chae

TL;DR
Scientists isolated a tick-borne virus from a wild leopard cat in South Korea, showing it is closely related to strains found in humans and domestic cats.
Contribution
First confirmed case of natural SFTSV infection and successful virus isolation from a wild leopard cat in South Korea.
Findings
SFTSV was isolated from a wild leopard cat and showed high genetic similarity to strains from humans and domestic cats in South Korea.
The leopard cat strain had three unique amino acid mutations in the M and S segments.
The study suggests wild felids may serve as ecological indicators of SFTSV transmission.
Abstract
Bandavirus dabieense severe fever with thrombocytopenia syndrome virus (SFTSV) is an emerging tick‐borne zoonotic virus that causes severe febrile illness and high fatality rates in people. SFTSV is endemic to East Asia, notably in the Republic of Korea (ROK), Japan, and China. Although several studies have reported SFTSV infections in domestic cats (Felis catus), reports of SFTSV in wild felids have been lacking. Previous serological analyses suggest exposure to SFTSV in various wildlife species. However, the clinical outcomes and the role of these animals in SFTSV transmission remain unclear. This study reports the first isolation and whole‐genome analysis of SFTSV from a wild leopard cat (Prionailurus bengalensis euptilura) in the ROK. SFTSV was first detected in spleen tissue using real‐time PCR, successfully isolated in Vero E6 cells, and confirmed with nested PCR and…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6| Segments | Nucleotide identity (%) | Amino acid identity (%) | Positions | HB29 AA | KLC AA | Mutation | Proteins |
|---|---|---|---|---|---|---|---|
| L | 95.80 | 99.42 | 415 | S | G | S418G | RdRp core |
| 476 | V | I | V479I | ||||
| 563 | F | Y | F563Y | ||||
| 648 | V | I | V648I | ||||
| 716 | N | S | N716S | ||||
| 832 | K | R | K832R | ||||
| 1035 | T | S | T1035S | ||||
| 1113 | S | N | S1113N | ||||
| 1368 | V | I | V1368I | ||||
| 1681 | K | R | K1681R | Cap‐binding domain | |||
| 1714 | V | I | V1714I | ||||
| 1910 | R | K | R1910K | C‐terminal domain | |||
| M | 93.08 | 97.72 |
|
|
|
| Single peptide |
| 21 | S | T | S21T | Gn | |||
| 37 | G | N | G37N | ||||
| 114 | E | G | E114G | ||||
| 218 | G | S | G218S | ||||
| 273 | A | T | A273T | ||||
| 300 | E | G | E300G | ||||
| 321 | T | M | T321M | ||||
| 371 | R | K | R371K | ||||
| 385 | S | T | S385T | ||||
| 394 | H | Q | H394Q | ||||
| 501 | T | S | T501S | Gc | |||
| 506 | V | M | V506M | ||||
|
|
|
|
| ||||
| 525 | G | R | G525R | ||||
| 577 | R | K | R277K | ||||
| 587 | I | V | I587V | ||||
| 662 | P | S | P662S | ||||
| 904 | I | V | I904V | ||||
| 960 | I | T | I960T | ||||
| 962 | R | S | R962S | ||||
| 1011 | T | S | T1011S | ||||
| 1056 | F | S | F1056S | ||||
| 1058 | L | F | L1058F | ||||
| S | 94.80 | 97.14 |
|
|
|
| Np |
| 144 | Q | K | Q144K | ||||
| 197 | L | M | L197M | ||||
| 207 | P | S | P207S | ||||
| 223 | V | I | V223I | ||||
| 237 | E | D | E237D | ||||
| 245 | H | Q | H245Q | ||||
| 249 | H | Y | H249Y | ||||
| 99.60 | 52 | K | R | K25R | Ns |
| Segments | Host (ref accession numbers, countries, genotypes) | Nucleotide identity (%) | AA identity (%) | Amino acid mutation | ||||
|---|---|---|---|---|---|---|---|---|
| Position | Ref AA | KLC AA | Mutation | Protein | ||||
| L | Human ( | 99.90 | 99.90 | 1338 | F | Y | F1338Y | RdRp core |
| 2001 | G | S | G2001S | |||||
| Cat ( | 99.90 | 99.95 | 1356 | G | E | G1356E | ||
| Cheetah ( | 96.45 | 99.42 | 137 | T | A | T137A | Endonuclease | |
| 237 | K | R | K237R | |||||
| 311 | S | G | S311G | RdRp core | ||||
| 378 | I | V | I378V | |||||
| 415 | S | G | S415G | |||||
| 476 | V | I | V476I | |||||
| 545 | Y | F | Y545F | |||||
| 693 | S | T | S693T | |||||
| 1368 | V | I | V1368I | |||||
| 1444 | I | V | I1444V | |||||
| 1910 | R | K | R1910K | C‐terminal | ||||
| 2035 | R | K | R2035K | |||||
| Cat ( | 96.19 | 99.52 | 311 | S | G | S311G | RdRp core | |
| 415 | S | G | S145G | |||||
| 476 | V | I | V476I | |||||
| 783 | K | E | K783E | |||||
| 1005 | T | A | T1005A | |||||
| 1113 | S | N | S1113N | |||||
| 1368 | V | I | V1368I | |||||
| 1444 | I | V | I1444V | |||||
| 1645 | D | E | D1645E | |||||
| 1910 | R | K | R1910K | C‐terminal | ||||
| Human ( | 96.31 | 99.28 | 64 | M | L | M64L | Endonuclease | |
| 311 | S | G | S311G | RdRp core | ||||
| 378 | I | V | I378V | |||||
| 415 | S | G | S415G | |||||
| 476 | V | I | V476I | |||||
| 688 | V | D | V688D | |||||
| 792 | T | S | T792S | |||||
| 1113 | S | N | S1113N | |||||
| 1368 | V | I | V1368I | |||||
| 1444 | I | V | I1444V | |||||
| 1472 | S | C | S1472C | |||||
| 1714 | V | I | V1714I | |||||
| 1816 | H | Q | H1816Q | C‐terminal | ||||
| 1910 | R | K | R1910K | |||||
| M | Human ( | 99.84 | 99.81 |
|
|
|
| Single peptide |
|
|
|
|
| Gc | ||||
| Cat ( | 99.81 | 99.81 |
|
|
|
| Single peptide | |
|
|
|
|
| Gc | ||||
| Cheetah ( | 95.93 | 99.15 |
|
|
|
| Single peptide | |
| 14 | I | V | I14V | |||||
| 83 | F | Y | F83Y | Gn | ||||
| 185 | S | P | S185P | |||||
| 298 | T | A | T298A | |||||
| 300 | E | G | E300G | |||||
|
|
|
|
| Gc | ||||
| 553 | A | T | A553T | |||||
| 904 | I | V | I904V | |||||
| Cat ( | 95.97 | 98.49 |
|
|
|
| Single peptide | |
| 170 | N | D | N170D | Gc | ||||
| 300 | E | G | E300G | |||||
| 301 | S | A | S301A | |||||
| 321 | I | M | I321M | |||||
| 404 | A | T | A404T | |||||
| 411 | T | A | T411A | |||||
| 459 | A | V | A459V | Gn | ||||
| 491 | V | M | V491M | |||||
|
|
|
|
| |||||
| 530 | E | D | E530D | |||||
| 553 | A | T | A553T | |||||
| 577 | R | K | R577K | |||||
| 817 | S | T | S817T | |||||
| 904 | I | V | I904V | |||||
| 1065 | I | V | I1065V | |||||
| Human ( | 96.34 | 98.96 | 4 | I | V | I4V | Single peptide | |
|
|
|
|
| |||||
| 300 | E | G | E300G | Gc | ||||
| 403 | R | K | R403K | |||||
|
|
|
|
| Gn | ||||
| 554 | V | I | V554I | |||||
| 557 | V | I | V557I | |||||
| 560 | S | A | S560A | |||||
| 904 | I | V | I904V | |||||
| 953 | Q | L | Q953L | |||||
| 1070 | S | T | S1070T | |||||
| S | Human ( | 99.88 | 99.65 |
|
|
|
| NSs |
| Cat ( | 99.94 | 99.65 |
|
|
|
| ||
| Cheetah ( | 95.82 | 98.58 |
|
|
|
| ||
| 144 | Q | K | Q144K | |||||
| 237 | E | D | E237D | |||||
| 243 | I | V | I243V | |||||
| 99.60 | 237 | A | V | A237V | Np | |||
| Cat ( | 95.64 | 98.93 | 35 | K | R | K35R | NSs | |
|
|
|
| F118S | |||||
| 237 | E | D | E237D | |||||
| 99.60 | 95 | K | R | K95R | Np | |||
| Human ( | 96.59 | 97.86 | 17 | S | N | S17N | NSs | |
| 22 | K | R | K22R | |||||
|
|
|
| F118S | |||||
| 144 | Q | K | Q144K | |||||
| 237 | E | D | E237D | |||||
| 283 | K | R | K283R | |||||
| 99.60 | 63 | K | R | K63R | Np | |||
- —National Institute of Wildlife Disease Control and Prevention (NIWDC)
- —Ministry of Environment10.13039/501100003562
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsViral Infections and Vectors · Vector-borne infectious diseases · Vector-Borne Animal Diseases
1. Introduction
Severe fever with thrombocytopenia syndrome (SFTS) is a tick‐borne zoonotic disease caused by Bandavirus dabieense (SFTS virus [SFTSV]), a negative‐sense single‐stranded RNA virus belonging to the genus Bandavirus in the family Phenuiviridae [1]. SFTS was first identified in central China in 2009 and has since been reported in Japan, the Republic of Korea (ROK), Pakistan, Thailand, Myanmar, Vietnam, and Taiwan [2–9]. In the ROK, human cases of SFTSV are reported annually, with a cumulative fatality rate of 18.2% [10]. The primary route of SFTSV transmission is through infected tick bites. However, direct transmission from infected domestic cats (Felis catus) to humans has also been reported, particularly among veterinary personnel who had no history of tick exposure [11]. In domestic cats, SFTSV infection causes fatal clinical signs such as jaundice, gastric hemorrhage, and acute necrotizing lymphadenitis [12–14]. These findings suggest that felines are not only susceptible to SFTSV but may also serve as a zoonotic risk. Among wild animals, the leopard cat (Prionailurus bengalensis euptilura), a class II endangered species under the Wildlife Conservation Act in the ROK, has not been previously studied for SFTSV infection. While domestic cats have been identified as a potential risk factor for direct human infection, the ecological role of wild leopard cats in SFTSV circulation remains largely unknown. Given that wildlife species frequently interact with ticks, they can serve as important ecological indicators of pathogen circulation within natural environment. In this study, we detected, isolated, and characterized the whole genome of SFTSV from a wild leopard cat (Prionailurus bengalensis euptilura), providing new insight into SFTSV occurrence in a wildlife host in the ROK. These findings contribute to understanding the epidemiology of SFTSV in wildlife and underscore the need for enhanced One health‐based surveillance to better elucidate the ecological dynamics and cross‐boundary circulation of SFTSV among wildlife populations.
2. Materials and Methods
2.1. Ethical Approval
The sample originated from a wildlife carcass that died from natural causes. No ethical approval or permit for this sampling was required. Subsequent virus isolation was approved by the Jeonbuk National University Institutional Biosafety Committee (IBC) (IBC Number JBNU 2025‐06‐001), conducted in strict accordance with the recommendations of the national guidelines.
2.2. Spleen Collected From a Rescued Wild Leopard Cat
On October 15, 2024, the carcass of a juvenile leopard cat (Prionailurus bengalensis euptilura) was reported by a local resident and subsequently examined on site at Nodol‐ri 583‐1, Daehung‐myeon, Yesan‐gun, and Chungcheongnam‐do. Upon arrival, the animal was found dead in a concrete agricultural drainage ditch situated in a mountainous area, with the Sinyangcheon stream located within a 2‐km radius. The carcass was submitted through a nearby wildlife rescue center, and no remarkable gross lesions were observed during necropsy. The spleen sample was collected and stored at −80 °C until further analysis, as previous experimental infection studies in mammalian hosts have demonstrated that the spleen consistently harbors high SFTSV viral loads [12, 15].
2.3. RNA Extraction
The spleen sample from the leopard cat was homogenized using a FastPrep‐24 Classic Bead homogenizer (MP biomedicals, Seoul, ROK), with zirconia beads (InVirusTech, Gwangju, ROK) following the manufacturer’s protocol. Viral RNA was extracted from the supernatant of homogenized tissue samples using the Maxwell RSC Simply RNA tissue kit (Promega, Madison, Wisconsin, USA), following the manufacturer’s protocol.
2.4. Detection of SFTSV RNA by Real‐Time RT‐PCR
To detect the amplified M and S segments of SFTSV, real‐time RT‐PCR was simultaneously performed. Analysis using the PowerChek SFTSV Real‐time PCR kit (Kogenebiotech, Seoul, ROK) was performed on the QuantStudio 5 (Applied Biosystems Inc., Waltham, Massachusetts, USA) in a total volume of 20 μL (15 μL of PCR mixture and 5 μL of template RNA and PCR control), according to the manufacturer’s instructions. Positive results were defined by a cycle threshold (Ct) value ≤35 for the M and S segments.
2.5. SFTSV Isolation
Vero E6 cells were seeded in a T‐75 flask at a concentration of 1 × 10^7^ cells per 14 mL of Dulbecco’s Modified Eagle’s Medium (DMEM; HyClone, Marlborough, Massachusetts, USA), supplemented with 2% fetal bovine serum (HyClone, Marlborough, Massachusetts, USA). A 0.1 g of the spleen from the wild leopard cat was prepared in a 1.5 mL tube using sterile scissors, washed immediately with 70% ethanol, and then washed three times with phosphate‐buffered saline (PBS). The spleen was homogenized using an autoclaved homogenizer with 350 μL free DMEM and centrifuged at 4°C, 13,000 rpm (16,790 g), and the supernatant was collected. The supernatant was filtered through a 30 mL syringe and a 0.45 μm filter. After confirming the formation of Vero E6 cell monolayers, 200 μL of supernatant was added to the T‐75 flask. The flask was incubated at 37°C with 5% CO_2_ in a humidified incubator for 3–10 days. For each passage confirmed to be SFTSV‐positive, both the supernatant and cells were collected and tested using nested PCR targeting the S segment. Only PCR‐positive cultures were used for the next passage. In the ROK, SFTSV is classified as a biosafety level (BL)‐3 pathogen; therefore, all experiments involving SFTSV were conducted in a BL‐3 laboratory at the Korea Zoonosis Research Institute, Jeonbuk National University.
2.6. RT‐Nested PCR
The RT‐nested PCR was employed to enhance the sensitivity of SFTSV detection in cell culture, since viral load can be extremely low during early passages of SFTSV isolation.
The first‐round PCR was performed in a OneStep RT‐PCR Pre‐Mix (SolGent, Daejeon, Korea) with 10 pmol of primers and 4 μL of template. The conditions were performed at 50°C for 30 min and 95°C for 15 min; the reaction was then carried out for 40 cycles at 95°C for 20 s, 52°C for 40 s, and 72°C for 30 s, with a final elongation at 72°C for 5 min.
The second‐round PCR was performed in a BioFACTTM 2 × Taq PCR Pre‐Mix (BioFACT, Daejeon, Korea) with 10 pmol of primers and 1 μL of template from the first‐round PCR. The conditions included denaturation at 94°C for 5 min, followed by 25 cycles of 94°C for 20 s, 55°C for 40 s, 72°C for 30 s, with a final elongation at 72°C for 5 min.
The first‐round PCR primers were NP‐2F (5′‐CATCATTGTCTTTGCCCTGA‐3′) and NP‐2R (5′‐AGAAGACAGAGTTCACAGCA‐3′) [16]. The second‐round PCR primers were N2‐F (5′‐AAYAAGATCGTCAAGGCATCA‐3′) and N2‐R (5′‐TAGTCTTGGTGAAGGCATCTT‐3′) [17].
2.7. Indirect Immunofluorescence Assay (IFA)
IFA slides were prepared using SFTSV‐infected Vero E6 cells. The Vero E6 cells were seeded in T‐75 flasks at a concentration of 3 × 10^4^ cells per 14 mL of DMEM supplemented with 2% FBS. The cells were then transferred to a 24‐well slide and incubated at 5% CO_2_ for 16 h. The slides were fixed with 100% acetone for 10 min at −20 °C. After fixation, 5% normal rabbit serum diluted in PBS was applied for 90 min for blocking. To confirm SFTSV infection, we used SFTSV‐positive serum obtained from a Korean water deer that had been previously confirmed positive in earlier tests. This serum served as the primary antibody and was diluted 1:50 in PBS, followed by incubation for 2 h. After washing with PBS, FITC‐conjugated rabbit anti‐deer IgG (H + L) (Sera Care, Milford, MA, USA) was added as the secondary antibody and incubated for 1 h at 5% CO_2_. A 4′,6‐Diamidino‐2‐phenylindole (DAPI) was used for nuclear staining. The results were visualized using the EVOS M7000 Imaging System (Invitrogen, Frederick, MD, USA).
2.8. Whole‐Genome Sequencing
Whole‐genome sequencing was performed in Vero E6 cell‐isolated SFTSV derived from the spleen of a wild leopard cat after viral isolation. Total RNA was used for library preparation with the TruSeq Stranded Total RNA with Ribo‐Zero H/M/R kit (Illumina, San Diego, USA), following the manufacturer’s protocol, and sequencing was conducted by Macrogen (Seoul, ROK). Raw sequencing data were processed through quality filtering (Q20 ≥90%), adapter trimming using Trimmomatic v0.38, and quality assessment using FastQC v0.11.7. De novo assembly of the viral genome was performed using SPAdes v3.15.0, and nucleotide analysis of the S, M, and L segments was performed based on the assembled contigs. Reference sequences for the SFTSV segments were obtained from the National Center for Biotechnology Information database (NCBI, USA). For whole‐genome sequencing, viral RNA was extracted from the Vero cell culture supernatant at passage 3.
2.9. Amino Acid Mutation and Distance Analysis
Sequence and nucleotide identity were assessed based on p‐distance metrics using MEGA 7 software for each genome segment (L, M, and S). Amino acid sequences of the L, M, and S segments were obtained by translating open reading frames (ORFs) using the NCBI ORF finder (https://www.ncbi.nlm.nih.gov/orffinder/). The translated protein sequences were aligned with those of the human reference strain SFTSV HB29 (GenBank Accession Numbers: NC_018136, NC_018137, and NC_018138, for the L, M, and S segments, respectively). For comparison with same sub‐genotype B‐1, sequences from human (MG737019, MG737128, and MG737236) and domestic cat (MZ363633, MZ352108, and MZ342903) were used. To compare with other feline species, sequences from cheetah (LC325234, LC325236, and LC325238) belonging to sub‐genotype B‐2 and domestic cat (OL773689, OL773688, and OK423755) belonging to sub‐genotype B‐3 were included. The muscle algorithm implemented in the Molecular Evolutionary Genetics Analysis (MEGA) 7 software was for sequence alignment. The resulting alignments were exported in FASTA format and visualized in Jalview v2.11.2.7 (https://www.jalview.org/). Amino acid substitutions were identified manually by comparing each aligned residue with the above reference sequence.
3. Results
3.1. Detection of SFTSV RNA
Real‐time RT‐PCR was performed on the spleen sample obtained from the wild leopard cat, targeting the M and S segments of SFTSV. SFTSV RNA was detected, with Ct values of 25.996 and 24.873 for the M and S segments, respectively (Figure 1). This Ct value indicating a relatively high viral RNA load in the spleen tissue.
Figure 1. Overall results of detection and isolation of SFTSV from a wild leopard cat in Chungcheongnam‐do, October 2024. (A) Real‐time PCR of spleen sample: red line, S segment; blue line, M segment; green line, positive control. (B) SFTSV isolation confirmed by nested PCR. Gel electrophoresis of first‐ and second‐round PCR; M, DNA marker; lane 1, uninfected control; lane 2–5, passage 2 and 3 supernatant and cells from first‐round PCR (461 bp); lane 6–10, same for second‐round PCR (346 bp). (C) Results of SFTSV antigen detection in the isolated SFTSV from a wild leopard cat in Vero E6 cells by IFA. (C1) 1:50 dilution ratio in SFTSV positive serum and PBS; (C2) water control using PBS. FITC‐labeled rabbit anti‐deer IgG. Blue color represents 4′, 6‐diamidino‐2‐phenylindole, and the green color represents green fluorescent protein. Scale bar = 75 μm.(A)(B)(C)
3.2. Isolation of SFTSV
SFTSV was successfully isolated from the spleen of a deceased wild leopard cat using Vero E6 cells. After the third passage, viral RNA was detected in the culture supernatant by nested PCR for each passage (Figure 1B). The presence of SFTSV antigen in infected cells was confirmed by IFA using a 1:50 dilution of positive serum from a cat (Figure 1C). Specific cytoplasmic fluorescence was observed in SFTSV‐infected cells, while no fluorescence was detected in the PBS control.
3.3. Pairwise Nucleotide and Amino Acid Identity
After de novo assembly, sequencing reads were mapped back to the assembled SFTSV genome. A total of 47,894 reads were aligned, resulting in 100% genome coverage with an average depth of 168.6x. The complete genome sequences were deposited in GenBank under accession numbers PV816800 (L), PV816801 (M), and PV816802 (S). Based on phylogenetic analysis, the strain was classified as sub‐genotype B‐1 (Figure 2). The raw sequencing data generated from the Vero cell‐isolated SFTSV in this study have been deposited in the NCBI Sequence Read Archive (SRA) under accession number SRR36445422, associated with BioSample SAMN54099721 and BioProject PRJNA1381260.
Figure 2. Phylogenetic relationships for severe fever with thrombocytopenia syndrome virus (SFTSV) detected in the spleen of a wild leopard cat (Prionailurus bengalensis euptilura) based on whole nucleotide sequences. The tree shows the comparison between the SFTSV sequences in the present study and the reference sequences. The sequences identified from the SFTSV‐positive wild leopard cats’ spleen are shown in boldface and red dots. Maximum likelihood analysis was used to construct the phylogenetic tree under the Kimura two‐parameter model (1000 bootstrap replicates), using sequences obtained from the ROK. (A) SFTSV whole nucleotide sequences of the L segment (6277 bp); (B) SFTSV whole nucleotide sequences of the M segment (3378 bp); and (C) SFTSV whole nucleotide sequences of the S segment (1647 bp). Red dots indicate the sequences obtained in this study for SFTSV isolated from a wild leopard cat in the ROK.(A)(B)(C)
Pairwise nucleotide distances analysis of the L, M, and S segments revealed that the reference human strain HB29, classified as genotype D, shared 93.08%−95.80% nucleotide identity and 97.14%−99.42% amino acid identity with the leopard cat strain (Table 1). SFTSV isolated from the wild leopard cat shared the highest nucleotide identity, 99.81%–99.94% and amino acid identity, 99.65%–99.95% with sub‐genotype B‐1 strains from domestic cats and humans. In comparison, sub‐genotype B‐2 strains from cheetahs exhibited nucleotide identities ranging from 95.93% to 96.45% and amino acid identities ranging from 98.58% to 99.60%. The sub‐genotype B‐3 domestic cat strain showed nucleotide identity ranging from 95.64% to 96.19% and amino acid identity from 98.49% to 99.60%. The sub‐genotype B‐4 human strain showed nucleotide identity ranging from 96.31% to 96.59% and amino acid identity from 97.86% to 99.28% in the L, M, and S segments (Table 2).
3.4. Amino Acid Mutations
Amino acid sequence comparison revealed 3, 2, and 1 substitutions in the L, M, and S segments, respectively, between the wild leopard cat strain and the cat and human strains within the identical sub‐genotype B‐1. In contrast, the sub‐genotype B‐2 strain from a cheetah exhibited 12, 9, and 5 amino acid substitutions in the L, M, and S segments. The sub‐genotype B‐3 strain from a domestic cat showed 10, 16, and 4 mutations in the L, M, and S segments. The sub‐genotype B‐4 strain from a human showed 14, 11, and 7 mutations in the L, M, and S segments. The human reference strain HB29, belonging to genotype D, demonstrated 13, 24, and 9 substitutions in the L, M, and S segments, respectively. Notably, only the leopard cat strain had unique mutations, C12Y, and H518Q in the M segment, which encodes a single peptide and Gc glycoproteins, and F118S in the S segment, which encodes nonstructural proteins (Tables 1 and 2).
4. Discussion
SFTSV infections in wild animals play a crucial role in circulating the virus and may serve as key indicators for surveillance of potential outbreaks in specific regions [18]. Notably, SFSTV has also been detected in wild leopard cat inhabiting Tsushima Island, Japan, indicating that felid populations across East Asia may be exposed to the virus under diverse ecological conditions [19]. In this study, we successfully isolated SFTSV from a wild leopard cat in the ROK and performed whole‐genome characterization, providing further evidence of SFTSV circulation in wild felids within the region. Phylogenetic analysis revealed that the isolated strain exhibited the highest sequence similarity to previously reported SFTSV strains from domestic cats and humans in the ROK, all belonging to sub‐genotype B‐1. In the ROK, genotype B is the most prevalent SFTSV genotype, and it has been associated with the highest case fatality rate in an animal model, particularly sub‐genotype B‐1, which showed the most efficient viral replication and resulted in a 100% mortality rate within 12 days post‐infection (dpi) in aged ferrets [20]. Recently, genotype B‐4 has been reported, and its inclusion allows a more comprehensive comparison of genetic diversity [21].
To investigate amino acid mutations, compared the SFTSV strain isolated from the leopard cat with HB29, a well‐characterized human reference strain belonging to genotype D. In addition, feline‐derived and human SFTSV strains of the same genotype but different sub‐genotypes were analyzed to assess broader genomic differences. Despite belonging to the same genotype and Felidae family, the leopard cat strain exhibited several unique amino acid substitutions not observed in strains from other hosts. Unlike domestic or captive felines living in relatively controlled environments, wild felines are exposed to a broader range of ecological pressures, including translocation, habitat disturbance, and other anthropogenic factors [22]. Among the amino acid substitutions observed in the leopard cat strain, the M segment, which encodes the Gn and Gc glycoproteins, exhibited the highest number of substitutions when compared with HB29. Notably, the C12Y and H518Q mutations were unique to the leopard cat strain and absent from strains of all other hosts, including those of the same genotype. Given that the Gn/Gc precursor glycoprotein is cleaved by a signal peptidase to produce mature Gn and Gc, both of which are essential for viral entry [23]. In addition, another unique substitution, F118S, was identified in the nonstructural protein NSs encoded by the S segment, which is known to regulate host innate immune response and form viroplasm‐like structures [24]. It has been suggested that host‐specific adaptations or selective pressures can shape the extent of within host diversity in RNA viruses [25]. This broader concept may help explain the unique amino acid substitutions observed in the SFTSV strain from the wild leopard cat, which could reflect host‐associated selective pressures acting in natural habitats. Although direct evidence for such mechanisms in SFTSV is currently lacking, these considerations provide a conceptual basis for interpreting the unique substitutions identified in this wildlife‐derived strain.
Members of the family Felidae, including domestic cats and captive cheetahs, have been reported to develop fatal illness upon SFTSV infection, exhibiting clinical signs such as leukopenia, anorexia, and jaundice, along with high case fatality [13, 26, 27]. In the present case, although no definitive pathological lesions were confirmed, SFTSV was detected in the spleen of a wild leopard cat found dead from an undetermined cause, suggesting that the infection may have contributed to its death. The animal was discovered in a concrete agricultural drainage ditch within a mountainous landscape and near a stream, an environment known to provide favorable conditions for active tick populations [28]. Although serological and molecular evidence of SFTSV infection has been reported in various wild animal species, successful virus isolation and whole‐genome analysis from wildlife remain limited [17, 18, 29]. This study provides the first complete genomic characterization of SFTSV isolated from a wild leopard cat in the ROK, offering valuable insights into the host range and circulation of SFTSV within wildlife. Together, these findings underscore the importance of continued one health based surveillance to better clarify the ecological dynamics and maintenance of SFTSV at the wildlife‐vector interface.
5. Conclusions
This study reports the first successful isolation of SFTSV from a wild leopard cat found dead from an unknown cause. Whole‐genome sequencing and amino acid analysis were conducted to characterize the viral strain. Although no definitive pathological lesions were identified, the findings suggest that SFTSV may have contributed to the animal’s death. These results highlight the need for enhanced surveillance of SFTSV in wildlife populations and underscore the importance of understanding its ecological dynamics within natural transmission systems.
Author Contributions
Hye-Ryung Byun: conceptualization, data curation, formal analysis, investigation, methodology, validation, visualization, writing – original draft. Su-Jin Chae: data curation, methodology, writing – original draft. Seong-Ryeong Ji: methodology, validation. Hak Sub Shin: resources, investigation, methodology. Jun-Gu Kang: resources. Hyesung Jeong: data curation, resources, investigation, validation. Suwoong Lee: resources, validation. Joon-Seok Chae: project administration, supervision, writing, review, editing. Hye‐Ryung Byuna and Su‐Jin Chae are the Co‐first authors, these authors contributed equally to this work.
Funding
This work was supported by the National Institute of Wildlife Disease Control and Prevention (NIWDC), funded by the Ministry of Environment (MOE) of the Republic of Korea (Grant NIWDC‐2024‐RP‐01).
Conflicts of Interest
The authors declare no conflicts of interest.
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1ICTV , ICTV Taxonomy History: SFTS Virus, 2025, (ICTV) https://ictv.global/taxonomy/taxondetails?taxnode_id=202400166&taxon_name=Bandavirus%20dabieense.
- 2Yu X.-J. , Liang M.-F. , and Zhang S.-Y. , et al.Fever With Thrombocytopenia Associated With a Novel Bunyavirus in China, New England Journal of Medicine. (2011) 364, no. 16, 1523–1532, 10.1056/NEJ Moa 1010095, 2-s 2.0-79955166070.21410387 PMC 3113718 · doi ↗ · pubmed ↗
- 3Takahashi T. , Maeda K. , and Suzuki T. , et al.The First Identification and Retrospective Study of Severe Fever With Thrombocytopenia Syndrome in Japan, The Journal of Infectious Diseases. (2014) 209, no. 6, 816–827, 10.1093/infdis/jit 603, 2-s 2.0-84895733263.24231186 PMC 7107388 · doi ↗ · pubmed ↗
- 4Kim K.-H. , Yi J. , and Kim G. , et al.Severe Fever With Thrombocytopenia Syndrome, South Korea, 2012, Emerging Infectious Diseases. (2013) 19, no. 11, 1892–1894, 10.3201/eid 1911.130792, 2-s 2.0-84887005611.24206586 PMC 3837670 · doi ↗ · pubmed ↗
- 5Tran X. C. , Yun Y. , and Van An L. , et al.Endemic Severe Fever With Thrombocytopenia Syndrome, Vietnam, Emerging Infectious Diseases. (2019) 25, no. 5, 1029–1031, 10.3201/eid 2505.181463, 2-s 2.0-85065024907.31002059 PMC 6478219 · doi ↗ · pubmed ↗
- 6Zohaib A. , Zhang J. , and Saqib M. , et al.Serologic Evidence of Severe Fever With Thrombocytopenia Syndrome Virus and Related Viruses in Pakistan, Emerging Infectious Diseases. (2020) 26, no. 7, 1513–1516, 10.3201/eid 2607.190611.32568060 PMC 7323538 · doi ↗ · pubmed ↗
- 7Lin T.-L. , Ou S.-C. , and Maeda K. , et al.The First Discovery of Severe Fever With Thrombocytopenia Syndrome Virus in Taiwan, Emerging Microbes & Infections. (2020) 9, no. 1, 148–151, 10.1080/22221751.2019.1710436.31918622 PMC 6968498 · doi ↗ · pubmed ↗
- 8Win A. M. , Nguyen Y. T. H. , and Kim Y. , et al.Genotypic Heterogeneity of Orientia tsutsugamushi in Scrub Typhus Patients and Thrombocytopenia Syndrome Co-Infection, Myanmar, Emerging Infectious Diseases. (2020) 26, no. 8, 1878–1881, 10.3201/eid 2608.200135.32687023 PMC 7392420 · doi ↗ · pubmed ↗
