First report of Escherichia albertii in Iran: a case study highlighting diagnostic challenges in pediatric gastroenteritis
Ali Dadvar, Ali Nemati, Maryam Hafiz, Zahra Khammar, Ute Römling, Mahdi Askari Badouei, Gholamreza Hashemi Tabar

TL;DR
This paper reports the first case of Escherichia albertii in Iran, highlighting its role in pediatric gastroenteritis and the challenges in diagnosing it.
Contribution
The first documented case of E. albertii in Iran and the diagnostic challenges it presents in clinical settings.
Findings
E. albertii was identified in a 5-year-old girl with severe diarrhea in Iran.
The strain showed resistance to common antibiotics like ampicillin and amoxicillin-clavulanate.
Phenotypic tests often misidentify E. albertii, emphasizing the need for PCR-based diagnostics.
Abstract
Escherichia albertii is a gram-negative, facultative anaerobic bacillus in the order Enterobacterales, family Enterobacteriaceae, increasingly recognized as an emerging enteropathogen. Initially isolated in 1991 from a child with diarrhea in Bangladesh and misclassified as Hafnia alvei, it was reclassified in 2003 and is now acknowledged as the second pathogenic species of the Escherichia genus, following Escherichia coli. This article reports the first documented case of E. albertii in Iran, infecting a 5-year-old girl who presented with profuse watery diarrhea. During a 7-month surveillance study at Akbar Children’s Hospital in Mashhad, stool samples from 231 children with diarrhea were analyzed, with this single case demonstrating infection by E. albertii. The strain was identified through pentaplex PCR but exhibited phenotypic traits highly similar to other enteropathogens and…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
| Test | Reaction | Test | Reaction |
|---|---|---|---|
| Oxidase | − | Lactose fermentation | − |
| Catalase | + | Mucate utilization | − |
| Indole | + | Nitrate reduction | + |
| Motility | − | Acetate utilization | − |
| Voges-Proskauer | − | Gelatin hydrolysis | − |
| Methyl red | + | Eosin methylene blue agar | − |
| Urease | − | Mannitol salt agar | − |
| Ortho-nitrophenyl-β-galactoside | + | Xylose fermentation | − |
| Citrate utilization | − | Deoxyribonuclease | − |
| Triple sugar iron agar | K/A | Adonitol fermentation | − |
| Hydrogen sulfide production | − | Mannitol fermentation | + |
| Lysine decarboxylase | + | D-sorbitol fermentation | + |
| Bile esculin hydrolysis | − | Salicin fermentation | − |
| Raffinose fermentation | − |
| Target gene | Sequence (5′−3′) | Primer | Amplicon size (bp) | Reference |
|---|---|---|---|---|
| Species-specific gene | ||||
| EAKF1_ch4033 | GTAAATAATGCTGGTCAGACGTTAAGTGTAGAGTATATTGGCAACTTC | Ealb_fw | 393 | ( |
| Virulence genes | ||||
| | Eae_fw | 384 | ( | |
| | ATAAATCGCCATTCGTTGACTACAGAACGCCCACTGAGATCATC | Stx1_fw | 180 | ( |
| |
| Stx2_fw | 255 | ( |
| |
| Stx2a_fw | ( | |
|
| Stx2a rev1 | 349 | ||
|
| Stx2a rev2 | 347 | ||
| |
| Stx2f fw | 428 | ( |
| |
| ehly_fw | 534 | ( |
| |
| CNF_fw | 450 | ( |
| |
| Sta_fw | 190 | ( |
| |
| LT_fw | 280 | ( |
| |
| Cdt-B fw | 407 | This study |
| |
| iroN_fw | 553 | ( |
| |
| ompT_fw | 496 | ( |
| |
| Paa_fw | 561 | This study |
| |
| hlyF_fw | 450 | ( |
| |
| Iss_fw | 323 | ( |
| |
| iucA_fw | 422 | This study |
| |
| iutA_fw | 302 | ( |
| Resistance genes | ||||
| |
| MultiTSO-T_fw | 800 | ( |
| |
| MultiTSO-O_fw | 564 | ( |
| |
| MultiTSO-S_fw | 713 | ( |
| |
| mcr1_320bp_fw | 320 | ( |
| |
| mcr2_700bp_fw | 715 | ( |
| |
| mcr3_900bp_fw | 929 | ( |
| |
| mcr4_1100bp_fw | 1,116 | ( |
| |
| MCR5_fw | 1,644 | ( |
| |
| qnrA_fw | 630 | ( |
| |
| qnrB_fw | 488 | ( |
| |
| qnrS_fw | 428 | ( |
| |
| qnrD_fw | 581 | ( |
| |
| qnrC_fw | 118 | ( |
| |
| aac(69)-Ib-cr_fw | 260 | ( |
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsEscherichia coli research studies · Viral gastroenteritis research and epidemiology · Clostridium difficile and Clostridium perfringens research
INTRODUCTION
Escherichia albertii is a gram-negative, facultative anaerobic bacillus within the Enterobacterales, family Enterobacteriaceae, recognized as an emerging enteropathogen. Initially isolated in 1991 from a 9-month-old child with diarrhea in Bangladesh as Hafnia alvei based on biochemical assays (1, 2), subsequent molecular analysis including DNA-DNA hybridization reclassified a group of D-sorbitol- and lactose-negative isolates as a novel species within the Escherichia genus in 2003. E. albertii has been named in honor of M. John Albert, who described its first isolate (1). This reclassification had demonstrated again the limitation to base taxonomy solely on biochemical tests and highlights the still evolving accuracy in bacterial taxonomy by the application of molecular methodologies such as PCR and whole genome sequence analyses including its significance for accurate identification of isolates in clinical settings.
E. albertii is now acknowledged as the second pathogenic species of the Escherichia genus, following Escherichia coli (3, 4). Its genomic complexity and close evolutionary relationship with both E. coli and Shigella (which actually belongs to the species E. coli) underscore its emerging status as a human and animal enteropathogen (5). With E. albertii to be traditionally linked to diarrhea in humans (6), experimental evidence has confirmed its potential to cause gastrointestinal disease, with adherence to epithelial cells identified as a primary virulence trait (7). Infected individuals often present with symptoms typical of gastroenteritis, including watery diarrhea, dehydration, abdominal pain, and, in some cases, fever (8, 9). Besides causing infection in humans, the foodborne pathogen E. albertii can also colonize wild and livestock animals, although it was initially not considered a zoonotic pathogen.
The diagnostic challenges posed by E. albertii stem from its genetic and phenotypic similarities to other Escherichia spp., in particular E. coli and Escherichia fergusonii (10). However, recently, the presence of a transcriptional activator (EAKF1_ch4033) has been found to be indicative of E. albertii (11). The detection of the eae gene, also associated with enteropathogenic Escherichia coli (EPEC) and enterohemorrhagic Escherichia coli (EHEC) strains of E. coli, can lead to misidentification of E. albertii in routine laboratory tests (12). As a result, E. albertii has previously been underreported concomitantly with a lack of awareness regarding its public health implications. This is particularly concerning, given the potential of some E. albertii strains to produce Shiga toxin and its association with causing intestinal lesions, which can result in significant morbidity (13–15). The genome of E. albertii KF1 is composed of a chromosome of 4,701,875 bp, exhibiting a G + C content of 49.7%, along with four plasmids. The application of multiplex PCR approaches for the identification of various gastrointestinal pathogens, including diarrheagenic E. coli, combined with whole genome sequencing for precise identification and typing, has established a more effective and dependable method for the detection and characterization of E. albertii (16, 17).
This article reports the first isolation of E. albertii from a 5-year-old child in Iran, highlighting its significance as an emerging public health concern. By investigating the prevalence of E. albertii in pediatric diarrhea cases, this study seeks to enhance understanding about the occurrence of diarrheal disease caused by E. albertii in Iran, the virulence factors involved, and the antimicrobial resistance profiles. The findings, therefore, contribute valuable insights into the epidemiology of this underestimated pathogen, filling a critical gap in knowledge about the pathogenic potential and informing better strategies for prevention and control of related infections in the region.
CASE PRESENTATION
The Akbar Children’s Hospital, a public facility in Mashhad, Iran, serves patients from across Khorasan and has an active surveillance program for diarrheal pathogens, including Salmonella, Shigella, Vibrio spp., and Campylobacter. Diagnosis and management of acute diarrhea in children follow the guidelines set by the Iranian Ministry of Health and the World Health Organization.
The patient, a 5-year-old girl from Mashhad, was previously healthy until May 1, 2022, when she developed profuse watery diarrhea without blood. She was admitted to the Akbar Children’s Hospital on the same day. She had not taken medications prior to disease development and had not been traveling outside Mashhad. Upon admission, tests for Salmonella and Shigella returned negative. The patient was stable and was discharged after one day in the hospital. However, her stool sample was subsequently sent to the microbiology department for further analysis in the context of a larger study on infectious agents.
Identification
During a 7-month study period, stool samples from 231 children with diarrhea were collected at the Akbar Children’s Hospital, but none of the samples tested positive for E. albertii aside from this case. The strain isolated from the patient’s stool at the hospital produced clear, colorless, circular colonies on MacConkey agar and has subsequently been identified as E. albertii using an improved multiplex PCR reaction targeting genes, the presence of which is discriminatory between relevant E. coli, relevant pathovars and Escherichia spp., namely E. coli, E. albertii, E. fergusonii, Shigella spp., and enteroinvasive E. coli (EIEC). This PCR approach includes detection of the gene for the cyclic di-GMP regulator CdgR (discriminatory for E. coli), for the DNA-binding transcriptional activator of cysteine biosynthesis EAKF1_ch4033 (specific for E. albertii), and for the palmitoleoyl-acyl carrier protein-dependent acyltransferase EFER_0790 (specific for E. fergusonii). By targeting ipaH and lacY the PCR assay additionally discriminated between Shigella spp. and EIEC (11, 18).
Upon successful amplification of the PCR product specific for E. albertii, the gene for the transcriptional activator EAKF1_ch4033 has been sequenced using the BigDye Terminator Cycle Sequencing Kit on an ABI PRISM 3130 Genetic analyzer (Thermo Fisher Scientific) according to the manufacturer’s instruction. EAKF1_ch4033 showed 99% nucleotide sequence identity to the equivalent gene of verified E. albertii isolates. The nucleotide sequence has been submitted to GenBank with accession number PV185715.
Moreover, the results of phenotypic and biochemical tests—negative for motility, oxidase, and lactose utilization and positive for catalase, indole, and utilization of mannitol and sorbitol—indicated the isolate being E. albertii (Table 1). Some biochemical and even behavioral traits, including sorbitol, lactose, indole, and motility, can, however, vary in E. albertii, with some isolates testing positive and others testing negative (19, 20). This variability highlights the diversity within the species. Therefore, these traits should be interpreted with caution when identifying E. albertii based on phenotypic tests.
Antimicrobial susceptibility was assessed using the Clinical and Laboratory Standards Institute disk diffusion method, with E. coli ATCC 25922 and Klebsiella pneumoniae K6 (ATCC 700603) serving as the quality control strain. The E. albertii strain was sensitive to trimethoprim-sulfamethoxazole, cefotaxime, meropenem, tetracycline, gentamicin, amikacin, ciprofloxacin, and azithromycin but resistant to ampicillin and amoxicillin-clavulanate. Additionally, we assessed the strain for the presence of 14 resistance-associated genes, including mcr1-5, blaTEM, blaSHV, blaOXA, and various qnr genes [qnrA-qnrD, qnrS, and aac(69)-Ib-cr] (Table 2). The amplification conditions were similar to previous studies, with minor adjustments to annealing temperatures as needed (21–23). Positive controls were included to confirm the accuracy of the PCR results, using Klebsiella pneumoniae (ATCC 700603) and E. coli (ATCC 35218), which carry blaTEM and blaSHV, respectively. A number of validated clinical isolates served as the positive controls for blaOXA, mcr1-5, and qnr genes. Only the blaTEM gene was detected in this strain, while all other resistance genes were absent. Demonstrating consistency between our phenotypic and PCR results, research has shown that the blaTEM gene is commonly found in ampicillin-resistant E. coli samples from humans (24, 25).
Recognizing that certain E. albertii strains may encode virulence factors similar to E. coli, we conducted single and multiplex PCR analyses to investigate the presence of a fraction of those virulence-associated genes. The genes examined included attachment gene eae and Paa; toxin genes stx1, stx2, stx2a, stx2f, hlyF, elt, est, cdt, iss, and ompT; enterohemolysin ehlY; and siderophore genes iucA, iutA, and iroN, all of which contribute to the pathogenicity of E. coli (Table 2). Paa (porcine attaching and effacing-associated gene coding for the Paa protein) and cdt (cytolethal distending toxin gene with its CdtB catalytic subunit) have previously been found in nearly 100% of E. albertii isolates (30). Multiple single and multiplex PCR assays were employed, adhering to established protocols (14, 26, 27, 29). E. coli O157 strain ATCC 35218 and E. coli O157 strain Sakai ATCC BAA-460 were used as positive controls for all these PCR reactions targeting virulence genes. Analysis of the results of the PCR reaction using agarose gel electrophoresis showed the presence of a specific-sized band for the eae, cdtB, Paa, iucA, and iutA genes (data not shown). The strain, designated E. albertii AD1, tested negative for all the other intestinal and extraintestinal virulence genes commonly found in E. coli.
DISCUSSION
Escherichia albertii is a gram-negative species increasingly recognized as a cause of human gastroenteritis (31). Historically, biochemical tests have led to misidentifications of E. albertii as E. coli, Shigella, Yersinia ruckeri, or Hafnia alvei (32). Infections can occur through the consumption of tainted water, vegetables, and meat or contact with contaminated animals (33). This case report marks the first documented occurrence of E. albertii in Iran, presenting a rare instance of diarrhea and hospitalization in a 5-year-old girl.
Mild diarrhea was a prominent symptom associated with E. albertii-AD1-related gastroenteritis in the patient. More severe pathogenesis may be attributed to virulence factors such as the stx1 and stx2 genes, along with the eae gene, which are known to interact with intestinal cells, leading to fluid accumulation and symptoms like diarrhea and abdominal pain. These virulence factors can also contribute to damage of the intestinal villi (34).
The biochemical properties of E. albertii closely resemble those of E. coli, with a few notable differences such as variable motility capacity, depending also on experimental conditions and in the fermentation of distinct sugars. For instance, E. albertii has conventionally been considered to be non-motile and unable to ferment certain sugars, including adonitol, xylose, and lactose, within 48 hours (2, 35, 36), while other biochemical traits can be variable. These biochemical and phenotypic similarities and variabilities often lead to its misidentification as E. coli and other species in routine biochemical tests (18, 35). In this epidemiological study, E. albertii AD1 was accurately identified as E. albertii through subsequent informative genomic analysis by multiplex PCR. Of note, phylogenetic grouping with the established multiplex PCR protocol (37) has not been successful (data not shown), providing additional indication for the isolate not belonging to the E. coli spp. As a specific molecular approach to identify E. albertii, to be generally applicable, the recently established identification of E. albertii by matrix-assisted laser desorption/ionization time-of-flight would require the inclusion of a specific database based on verified E. albertii isolates.
E. albertii AD1 carried a limited number of virulence genes, among them the eae adhesion initially thought to be an EPEC and the Paa adhesin gene, prevalent in strains of EHEC and ETEC pathovars and previously shown to be present in E. albertii (30). The cdtB gene was also detected in this strain; the cdtB gene in E. albertii encodes the active subunit of the cytolethal distending toxin, a tripartite genotoxin being encoded by cdtA, cdtB, and cdtC genes (38). In addition, we detected the iutA and iucA genes, which are part of the iucABCD-iutA operon. This operon encodes the high-affinity aerobactin siderophore system that aids in acquiring iron in iron-limited environments, such as within the host, and is considered an important virulence factor (39).
Although the average incubation period for infection by E. albertii is estimated to be 12–24 hours, the specific transmission route remained unclear in this case (32). The prevalence of E. albertii gastroenteritis appears to decline significantly with age, dropping from nearly 50% in children aged 0–10 years to 0% in adults over 20 (35). While these findings did not show statistically significant associations, they suggest that younger children are at greater risk of infection compared to adults. Previous studies support this observation, indicating that children under 10 and immunosuppressed individuals may be particularly vulnerable, although outbreaks have been reported in otherwise healthy populations (19).
While the source of infection has not been identified in this presented case, studies suggest that E. albertii may have zoonotic potential, with possible animal reservoirs serving as a source of infection. Various animal species, including poultry and livestock, have been implicated as carriers of E. albertii, which could be transmitted to humans (40, 41). Other factors such as poor hygiene during food preparation, the consumption of raw or undercooked poultry, and drinking untreated water may elevate the risk for E. albertii infection (1). The heightened incidence of clinical disease in younger age groups could reflect either a true association or sampling bias, as enteric infections can have more severe consequences for young children. Additionally, in cases of Shiga toxin-producing E. coli infections, children under 5 are more likely to develop hemolytic uremic syndrome (HUS). While not definitively confirmed, it is plausible that the risk of HUS in E. albertii infections may also be higher among young children, especially in strains that harbor both the stx2 and eae genes (41).
Conclusion
This report marks the first documented occurrence of E. albertii in Iran, highlighting a rare case of diarrhea and hospitalization in a 5-year-old girl. The strain exhibited resistance to antibiotics such as ampicillin and amoxicillin-clavulanate, underscoring challenges in treating infections caused by this pathogen. The diagnosis of E. albertii can be demanding and is often missed, but this case emphasizes the status of E. albertii as an emerging pathogen in both humans and animals. The findings show that E. albertii can cause diarrhea in children, warranting further investigation about additional virulence factors. Our understanding of its pathobiology, mechanisms of pathogenesis, virulence factors, and drug resistance remains limited even if recently more in-depth analyses have been performed (16, 17). Therefore, suspected E. albertii cases need to be interpreted with caution and confirmed through diagnostic PCR tests to ensure accurate diagnosis and appropriate management.
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1Gomes TAT, Ooka T, Hernandes RT, Yamamoto D, Hayashi T. 2020. Escherichia albertii pathogenesis. Eco Sal Plus 9:10-1128. doi:10.1128/ecosalplus.esp-0015-2019 PMC 1116857632588811 · doi ↗ · pubmed ↗
- 2Huys G, Cnockaert M, Janda JM, Swings J. 2003. Escherichia albertii sp. nov., a diarrhoeagenic species isolated from stool specimens of Bangladeshi children. Int J Syst Evol Microbiol 53:807–810. doi:10.1099/ijs.0.02475-012807204 · doi ↗ · pubmed ↗
- 3Gordon DM. 2011. Reservoirs of infection: the epidemiological characteristics of an emerging pathogen, Escherichia albertii. Div Ecol Evol Genet Res Sch Biol Aust Natl Univ Canberra. https://www.agriculture.gov.au/sites/default/files/sitecollectiondocuments/animal-plant/emergency/wildlifeexoticdiseaseprogram/08-09/epidemiological-char-pathogen-albertii.pdf.
- 4Li Q, Wang H, Xu Y, Bai X, Wang J, Zhang Z, Liu X, Miao Y, Zhang L, Li X, Zou N, Yan G, Chen X, Zhang J, Fu S, Fan R, Xu J, Li J, Xiong Y. 2018. Multidrug-resistant Escherichia albertii: co-occurrence of β-lactamase and MCR-1 encoding genes. Front Microbiol 9:258. doi:10.3389/fmicb.2018.0025829503643 PMC 5820351 · doi ↗ · pubmed ↗
- 5Retchless AC, Lawrence JG. 2010. Phylogenetic incongruence arising from fragmented speciation in enteric bacteria. Proc Natl Acad Sci U S A 107:11453–11458. doi:10.1073/pnas.100129110720534528 PMC 2895130 · doi ↗ · pubmed ↗
- 6Oaks JL, Besser TE, Walk ST, Gordon DM, Beckmen KB, Burek KA, Haldorson GJ, Bradway DS, Ouellette L, Rurangirwa FR, Davis MA, Dobbin G, Whittam TS. 2010. Escherichia albertii in wild and domestic birds. Emerg Infect Dis 16:638–646. doi:10.3201/eid 1604.09069520350378 PMC 3321939 · doi ↗ · pubmed ↗
- 7Albert MJ, Faruque SM, Ansaruzzaman M, Islam MM, Haider K, Alam K, Kabir I, Robins-Browne R. 1992. Sharing of virulence-associated properties at the phenotypic and genetic levels between enteropathogenic Escherichia coli and Hafnia alvei. J Med Microbiol 37:310–314. doi:10.1099/00222615-37-5-3101433251 · doi ↗ · pubmed ↗
- 8Albert MJ, Alam K, Islam M, Montanaro J, Rahaman AS, Haider K, Hossain MA, Kibriya AK, Tzipori S. 1991. Hafnia alvei, a probable cause of diarrhea in humans. Infect Immun 59:1507–1513. doi:10.1128/iai.59.4.1507-1513.19912004829 PMC 257869 · doi ↗ · pubmed ↗
