POLRMT overexpression increases mtDNA transcription without affecting steady-state mRNA levels
Maria Miranda, Andrea Mesaros, Nathalie Scrima, Louise Pérard, Irina Kuznetsova, Martin Purrio, Ilian Atanassov, Aleksandra Filipovska, Arnaud Mourier, Nils-Göran Larsson, Inge Kühl

TL;DR
Overexpression of POLRMT boosts mitochondrial DNA transcription initiation and exercise capacity in mice without affecting mature RNA levels.
Contribution
The study reveals that POLRMT overexpression enhances mtDNA transcription initiation without altering mature RNA levels or causing pathology.
Findings
POLRMT overexpression increases mtDNA transcription initiation and 7S RNA levels.
Steady-state levels of mature mitochondrial RNAs remain unaffected by elevated POLRMT.
Combined overexpression of POLRMT and Lrpprc does not increase mitochondrial transcript levels.
Abstract
This study investigates effects of increased POLRMT levels and reports stimulation of mtDNA transcription initiation and enhanced exercise capacity without an effect on steady-state mRNA levels. POLRMT is the sole RNA polymerase in human mitochondria, where it generates primers for mitochondrial DNA (mtDNA) replication and transcribes the mtDNA to express genes encoding essential components of the oxidative phosphorylation (OXPHOS) system. Elevated POLRMT levels are found in several cancers and in mouse models with severe mitochondrial dysfunction. Here, we generated and characterized mice overexpressing Polrmt to investigate the physiological and molecular consequences of elevated POLRMT levels. Increasing POLRMT levels did not result in any pathological phenotype but led to increased exercise performance in male mice under stress conditions. Polrmt overexpression increased mtDNA…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure S1
Figure S2
Figure S3
Figure S4
Figure 2
Figure 3
Figure S5
Figure 4
Figure S6
Figure 5
Figure S7
Figure 6- —French Muscular Dystrophy Association (AFM)http://dx.doi.org/10.13039/100013465
- —Agence Nationale de la Recherche (ANR)http://dx.doi.org/10.13039/501100001665
- —Cancerfonden (Swedish Cancer Society)http://dx.doi.org/10.13039/501100002794
- —Vetenskapsrådet (VR)http://dx.doi.org/10.13039/501100004359
- —Knut och Alice Wallenbergs Stiftelse (Knut and Alice Wallenberg Foundation)http://dx.doi.org/10.13039/501100004063
- —EC | European Research Council (ERC)http://dx.doi.org/10.13039/501100000781
- —Novo Nordisk Fonden (NNF)http://dx.doi.org/10.13039/501100009708
- —Fondation ARC pour la Recherche sur le Cancer (ARC)http://dx.doi.org/10.13039/501100004097
- —Department of Education and Training | Australian Research Council (ARC)http://dx.doi.org/10.13039/501100007912
- —Federal Government | DHAC | National Health and Medical Research Council (NHMRC)
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsMitochondrial Function and Pathology · ATP Synthase and ATPases Research · Cancer, Hypoxia, and Metabolism
Introduction
Biogenesis of the mitochondrial oxidative phosphorylation (OXPHOS) system is vital for mammalian life as it fulfils several metabolic functions, including the generation of most cellular energy in the form of ATP, and altered OXPHOS capacity is implicated in a broad range of human pathologies, including cancer and aging (Larsson, 2010; Whitehall & Greaves, 2020). The OXPHOS system is under dual genetic control by the nuclear and mitochondrial genomes, i.e., nDNA and mtDNA, respectively (Falkenberg et al, 2024). In mammals, the nDNA encodes most of the ∼1,200 mitochondrial proteins, including all factors required to express and maintain mtDNA and the vast majority of the ∼90 OXPHOS subunits (Morgenstern et al, 2021; Rath et al, 2021). In contrast, mammalian mtDNA only encodes 13 proteins that are all essential subunits of four of the five OXPHOS complexes, as well as two mitochondrial ribosomal RNAs (mt-rRNAs) and 22 transfer RNAs (mt-tRNAs) needed for mitochondrial protein synthesis. Failure to express mtDNA causes a global loss of mitochondrial protein complexes with dual genetic contributions, i.e., the OXPHOS complexes and the mitochondrial ribosome (Kühl et al, 2017), suggesting that regulation of mtDNA gene expression is not only essential for mitochondrial function but also allows local and rapid adaptations to bioenergetic and metabolic demands. Mammalian mtDNA is an intron-free, circular molecule present in hundreds to thousands of copies in most mammalian cell types. The mammalian mtDNA is not naked but fully coated and condensed into mitochondrial nucleoids by mitochondrial transcription factor A (TFAM) and other proteins (Kukat et al, 2015; García-Villegas et al, 2025). The compaction of the nucleoid varies; and the more relaxed form is accessible for mtDNA replication and transcription, whereas the more condensed form may serve to protect and store the genome (Bonekamp et al, 2021; Isaac et al, 2024; García-Villegas et al, 2025). The mammalian mtDNA is composed of two coding strands known as the heavy (H) and the light (L) strand because of the differences in their G+T base composition (Falkenberg et al, 2024). Mammalian mtDNA is only ∼16.5 kb in size, is densely packed with genes, and has only one long noncoding control region (NCR) of ∼1 kb. The NCR contains the H-strand origin of replication (O_H_) and promoters for transcription initiation of the H strand (HSP) and L strand (LSP). A second LSP was reported in human and apes (Tan et al, 2022; Falkenberg et al, 2024). Transcription of mtDNA generates near genome-length polycistronic transcripts that are processed to yield individual, mature RNA molecules (mt-RNAs) (Ojala et al, 1981; Montoya et al, 1982; Holzmann et al, 2008; Rackham et al, 2016; Siira et al, 2018). The link between posttranscriptional RNA processing and translation is not fully understood, but it has been shown that the leucine-rich pentatricopeptide repeat–containing protein (LRPPRC) and the stem–loop interacting RNA binding protein (SLIRP) form a heterodimeric protein complex that promotes polyadenylation and stabilizes all mt-mRNAs except the L-strand encoded mt-Nd6 (Gohil et al, 2010; Sasarman et al, 2010; Ruzzenente et al, 2012; Harmel et al, 2013; Rubalcava-Gracia et al, 2024).
The basal machinery for mitochondrial transcription is well understood and only consists of a limited set of proteins that are encoded by the nDNA and imported into mitochondria (Miranda et al, 2022; Falkenberg et al, 2024). The single-subunit mitochondrial RNA polymerase (POLRMT) operates exclusively in mitochondria (Ringel et al, 2011; Kühl et al, 2014, 2016) where it interacts with TFAM and mitochondrial transcription factor B2 (TFB2M) to initiate transcription (Hillen et al, 2017; Falkenberg et al, 2024). After initiation, TFAM and TFB2M leave POLRMT, which instead binds the mitochondrial transcription elongation factor (TEFM) to allow polycistronic transcription of both strands (Minczuk et al, 2011; Jiang et al, 2019). Transcription termination of the L-strand depends on the mitochondrial transcription termination factor 1 (MTERF1), whereas factors involved in termination of H-strand transcription remain to be clarified (Terzioglu et al, 2013). It should be emphasized that data from in vitro reconstituted pure recombinant systems, as well as atomic structures of transcription protein complexes (Wanrooij et al, 2008; Schwinghammer et al, 2013; Morozov et al, 2015; Posse et al, 2015; Hillen et al, 2018; Herbine et al, 2025) and several conditional knockout mouse models (Larsson et al, 1998; Kühl et al, 2016; Matic et al, 2018; Jiang et al, 2019), support the current models for transcription initiation, elongation, and termination (Miranda et al, 2022; Falkenberg et al, 2024). Despite this considerable progress in elucidating the basal molecular machinery for mtDNA transcription, the regulatory mechanisms remain poorly understood. Although several studies have suggested intramitochondrial roles for some nuclear transcription factors, this area remains controversial because biochemical in vitro reconstitution experiments and structural studies of how these nuclear factors directly interact with the basal mitochondrial transcription machinery are lacking (Rubalcava-Gracia et al, 2023).
Importantly, POLRMT also generates the RNA primers required for mtDNA replication initiation at the L-strand origin of replication (O_L_) and O_H_ (Kühl et al, 2016; Falkenberg, 2018; Sarfallah et al, 2021), placing this enzyme at the core of both mtDNA expression and maintenance. A proportion of LSP transcripts is terminated in the NCR (Wanrooij et al, 2012) to generate RNA primers for DNA synthesis at O_H_ (Falkenberg et al, 2024). The regulation of transcription for primer formation versus gene expression is partly understood, and different factors such as mitochondrial RNase H1 and mitochondrial single-strand binding protein (SSBP1) are of key importance in this process (Agaronyan et al, 2015; Kühl et al, 2016; Jiang et al, 2021; Misic et al, 2022).
Recent studies have highlighted the medical importance of understanding the regulation of mitochondrial transcription. Pathogenic mutations in POLRMT cause mitochondrial dysfunction with a broad spectrum of neurodevelopmental presentations in humans because of defective mitochondrial transcription (Oláhová et al, 2021). Elevated POLRMT levels are found in patients with lung and breast cancer (Sotgia et al, 2012) as well as in acute myeloid leukemia cells (Bralha et al, 2015; Chaudhary et al, 2021) and prostate cancer (Li et al, 2023). This association of elevated PORLMT levels with some cancers has led to the suggestion that POLRMT may be a novel important oncogene (Zhou et al, 2021; Miranda et al, 2022). Consistent with its putative role in cancer, POLRMT has been proposed as a therapeutic target to treat some cancers and specific small molecule inhibitors have been developed (Bonekamp et al, 2020; Li et al, 2023; Wang et al, 2024). Furthermore, increased POLRMT levels are found in many different mouse models with mitochondrial dysfunction (Milenkovic et al, 2013; Kühl et al, 2017; Jiang et al, 2019; Silva Ramos et al, 2019). It is unknown whether the increased POLRMT levels should be regarded as part of a compensatory mitochondrial biogenesis response or if they contribute to pathogenesis by worsening mitochondrial disease phenotypes. Here, we investigated the physiological and molecular consequences of elevated POLRMT levels in nonpathogenic conditions by generating and characterizing mice ubiquitously overexpressing Polrmt. The Polrmt-overexpressing mice are viable and have no evident pathologic phenotype by 1 yr of age, the latest time point studied. Remarkably, overexpression of Polrmt had a positive effect on performance under exercise challenge conditions. Molecular analysis of various tissues of the Polrmt-overexpressing mice suggests that POLRMT is limiting for mtDNA transcription initiation because elevated POLRMT levels increase de novo transcription and steady-state levels of the promoter-proximal 7S RNA transcript of the L-strand. Under normal conditions, this increase in mtDNA gene expression is not translated into an increase in OXPHOS capacity because mature mitochondrial transcripts are not globally up-regulated. Our findings support that regulatory checkpoints occur downstream of transcription initiation, balancing mtDNA transcription elongation and posttranscriptional processes depending on energetic needs in vivo.
Results
Overexpression of Polrmt results in healthy mice with normal OXPHOS
To study the role of moderately increased POLRMT levels, we generated mice ubiquitously overexpressing Polrmt using a bacterial artificial chromosome (BAC) transgenic strategy (Park et al, 2007). A BAC clone containing a fragment of mouse chromosome 10 with the Polrmt gene was modified to introduce a silent point mutation (c.420G>T) that generates a HindIII restriction site in exon 3, thus differentiating the introduced transgene from the endogenous Polrmt alleles (Figs 1A and B and S1A). This BAC transgenic strategy allows an increased expression of Polrmt regulated by its endogenous promotor and is predicted to increase Polrmt expression within a relevant physiological range. Germline transmission and expression of the transgene was verified by PCR and subsequent HindIII restriction digestion (Fig S1B). We observed ∼33% increase in Polrmt transcript levels (Fig 1C) as well as a comparable increase in POLRMT protein levels in the heart (Figs 1D and S1C). POLRMT levels were also increased in various other tissues such as the brown adipose tissue, kidney, liver, and spleen (Fig 1E). Quantification of the transgene copy number by pyrosequencing confirmed that a single copy was integrated into the mouse genome (Fig S1D). We did not obtain founders containing more than one additional copy of the Polrmt gene. The Polrmt-overexpressing mice were born at Mendelian ratios (Fig S2A) and had a normal body weight gain with females showing a slight but significant increase in body weight from 150 d of age (Fig 1F). Proportions of fat and lean mass were normal (Fig S2B and C), and Polrmt-overexpressing mice showed no abnormal behavior up until 52 wk of age. Furthermore, there was no evidence of cardiomyopathy as the heart-to-body weight ratios were normal at 13 and 26 wk (Fig S2D). No mice were euthanized because of abnormal cancerous masses during the course of the study. We next proceeded to evaluate whether moderately increased levels of POLRMT influenced the mitochondrial bioenergetic capacity. We found normal respiration of isolated mitochondria from the heart and liver incubated with complex I or complex II substrates and analyzed under phosphorylating (state 3), non-phosphorylating (state 4), or uncoupled conditions (Fig 1G), indicating normal OXPHOS function. To further verify our findings, we performed enzyme activity assays and Western blot analyses for respiratory chain complexes and found no differences between wild-type (WT) and Polrmt-overexpressing mice (Fig S3A and B). These results show that a moderate increase in POLRMT levels does not affect OXPHOS function or cause pathology.
*Polrmt-overexpressing mice are viable.(A) Scheme of BAC modification strategy. Chr, chromosome; E, exons; grey triangle indicates introduced HindIII restriction site and black triangles indicate endogenous restriction sites. Size of the DNA fragments generated after HindIII restriction and location of Southern blot are indicated at the bottom. (B) Representative Southern blot of BAC construct after HindIII restriction digest. (C) qRT-PCR analysis of steady-state Polrmt transcript levels in WT (+/+) and Polrmt overexpressor (+/T) mouse hearts at different ages. Normalization: TATA-binding protein (Tbp); n: 4–6 per genotype per age. (D, E) Representative Western blot of POLRMT levels in mitochondrial extracts +/+ and +/T from the heart with quantification (n: 11–13) (D) and from different tissues of a 52-wk-old mouse (n: 1) (E). Loading: VDAC; SKM, skeletal muscle; BAT, brown adipose tissue. (F) Body weight curves of female (upper) and male mice (lower); n: 7–16 per sex and genotype. g, grams; grey:+/T, white:+/+; ***P < 0.001 ANOVA repeated measurements (G) Oxygen consumption analysis on isolated mitochondria from the heart and liver. Mitochondria were incubated with pyruvate, glutamate, and malate to deliver electrons to complex I or with succinate and rotenone to deliver electrons to complex II (CII). Mitochondrial respiration was analyzed under phosphorylating (state 3), non-phosphorylating (state 4), and uncoupled conditions. n: 3 per age. Percentage (%) is calculated relative to +/+ levels. Error bars ± SEM. *P < 0.05, **P < 0.001; +/T and +/+ comparisons at different ages were tested within each age using a linear model with Tukey-adjusted pairwise tests.Source data are available for this figure.
Generation of endogenous Polrmt-overexpressing mice.(A) Detailed scheme of BAC modification strategy. Chr, chromosome; E, exons; asterisk point mutation introduced in c420. Sequencing chromatogram is shown. (B) PCR and restriction digest analysis of the Polrmt (G>T) BAC transgenic allele in genomic (gDNA) and reverse transcribed RNA (cDNA) from WT (+/+) and BAC transgenic Polrmt overexpressor (+/T) mice. (C) Western blots of POLRMT levels in mitochondrial extracts +/+ and +/T from the heart quantified in Fig 1D. 2 samples () were excluded from quantification because of issues with VDAC. (D) Pyrosequencing analysis of the ratio of WT (G) and transgenic (T) alleles in DNA isolated from tail biopsies in +/+ and +/T mice; n: 9 per genotype and sex.*
Polrmt-overexpressing mice are healthy.(A) Histogram of genotype distribution of the WT (+/+, white) and Polrmt-overexpressing (+/T, grey) offspring; n = 22–28 per genotype per sex, n.s: P > 0.05; chi-square test. (B, C) Fat mass percentage and (C) Lean mass percentage of 10-wk-old +/+ and +/T mice before starting the exercise challenge; n: 8–12 per sex per genotype. (D) Heart-to-body weight ratio at different ages; n: 3–5 per age and genotype.
Bioenergetic analyses in the heart and liver mitochondria.(A) Relative enzyme activity of respiratory chain enzymes measured in mitochondria isolated from the heart and liver at different ages. The enzymes measured are: Complex I: NADH ubiquinone oxidoreductase, Complex II: succinate dehydrogenase, Complex II-III: Succinate dehydrogenase—cytochrome c reductase, Complex IV: Cytochrome c oxidase, and citrate synthase (CS). n: 3 per age. (B) Western blot of OXPHOS subunit levels in isolated mitochondria from the heart at different ages; loading: VDAC. n: 3. Error bars ± SEM.
Moderately elevated POLRMT levels have a positive effect on exercise capacity
We assessed the effect of elevated POLRMT levels on animal physiology at 10, 26, and 52 wk of age. Using metabolic cages, we monitored the energy homeostasis and activity of Polrmt-overexpressing mice and WT littermates during the light and dark cycle. We did not detect significant differences in the drinking and feeding behavior or body weight gain (Fig S4A–C), showing that the overexpressing mice are stress free when kept under standard housing conditions. We determined the respiratory exchange ratio by measuring the O_2_ consumption and CO_2_ production and found no differences in substrate utilization in vivo between WT and Polrmt-overexpressing mice (Fig 2A). Surprisingly, when we studied the cumulative distance traveled in the metabolic chambers, we observed that Polrmt-overexpressing mice tended to display increased activity compared with control mice (Fig 2B). This increase was significant in males at 26 wk of age in the dark cycle, when mice are typically more active. We proceeded to study whether elevated POLRMT levels could be beneficial for exercise performance. Using monitored free-running wheels and several treadmill runs, we challenged the Polrmt-overexpressing and littermate control mice of both sexes to a voluntary and strenuous exercise regime (Fig 2C). Interestingly, voluntary exercise on free running wheels in the Polrmt-overexpressing mice significantly increased the capacity on a treadmill in comparison with controls in male mice (Fig 2D and E). The increased distance run on the treadmill test at 10–12 wk of age and the increased activity in 26-wk-old male mice show that moderate Polrmt overexpression can increase exercise capacity, the maximum amount of physical exertion that the mice can sustain (Goldstein, 1990).
Phenomaster parameters.(A) Body weight of female and male WT (+/+) and Polrmt-overexpressing (+/T) mice at different ages at the beginning of the indirect calorimetry experiment. (B) Water consumption. (C) Food consumption. n: 8–9 mice/genotype.
*Polrmt-overexpressing mice have increased exercise capacity.(A) Respiratory exchange rate normalized to lean body mass in female and male +/+ and +/T mice at different ages measured in metabolic cages; ticks in x-axis are spaced by 1 h; grey background, dark cycle; white background, light cycle; n: 7–9 mice/genotype/sex. (B) Cumulative distance travelled per day in +/+ and +/T mice at different ages; grey background, dark cycle; white background, light cycle; n: 7–9 mice/genotype/sex. (C) Scheme exercise challenge on 10–12-wk-old females and males +/+ and +/T mice. (D) Distance run on treadmill challenge at day 0, 8, and 15. n: 8–12 mice/genotype/sex. (E) Distance run in free running wheels during the exercise challenge. n: 8–12 mice/genotype/sex. Error bars ± SEM. *P < 0.05, **P < 0.001, ANOVA. +/T and +/+ comparisons at different ages were tested within each age using a linear model, adjusted for repeated measurements, and with Tukey-adjusted pairwise tests.Source data are available for this figure.
Polrmt overexpression has no effect on mtDNA levels
Given the essential role of POLRMT to serve as the primase that generates RNA primers for mtDNA replication (Falkenberg et al, 2024), we evaluated whether Polrmt overexpression affected mtDNA replication. We determined the steady-state mtDNA copy number by Southern blot and qPCR and found no significant changes in mtDNA levels in the heart of Polrmt-overexpressing mice at 14, 26, and 52 wk of age (Figs 3A–C and S5A and B). In organello mtDNA synthesis in isolated mitochondria showed a consistent trend toward an increase, but this difference was not statistically significant (Fig 3D and E). We further determined steady-state levels of essential factors for these processes but found no changes in Polrmt-overexpressing mice (Fig 3F). Our data show that a moderate elevation of POLRMT levels has no effect on mtDNA levels or TFAM levels (Figs 3F and S5A and B).
Polrmt overexpression leads to unaltered mtDNA copy number.(A) Representative Southern blot analysis of mtDNA levels at different ages. (B) Quantification of mtDNA levels from Southern blot at different ages in WT (+/+, white) and Polrmt overexpressor (+/T, grey) mice. Normalization 18S rDNA.; n: 4–6. (C) Quantification of mtDNA levels by qPCR using specific probes against mt-Co1, mt-Co2, mt-Nd6, and 18S rDNA. n > 4 per genotype. +/T and +/+ comparisons at different ages were tested within each age using a linear model. (D, E) Representative in organello replication on isolated mitochondria from the heart and (E) quantification of three experiments. Input: Western blot of SHDA and steady-state mtDNA levels. Normalization: protein input; n: 5 per genotype. Error bars ± SEM; grey:+/T, white:+/+. (F) Western blot of factors required for mtDNA replication expression in +/+ and +/T mice. Loading: VDAC; n: 3–4 per genotype; asterisk: unspecific band (Kühl et al, 2016).Source data are available for this figure.
mtDNA quantifications.(A) Images of Southern blot experiments quantified in Fig 3B. (B) Quantification of mtDNA levels by qPCR using specific probes against mt-Nd5, mt-Atp6, and 18S rDNA. n > 4 per genotype. +/T and +/+ comparisons at different ages were tested within each age using a linear model.
POLRMT levels may limit mitochondrial transcription in vivo
Next, we studied the effect of Polrmt overexpression on mtDNA transcription in mouse hearts. First, we assessed de novo transcription in isolated heart mitochondria from Polrmt-overexpressing mice and found a significant increase of ∼50% (Fig 4A and B). There was no accumulation of specific transcription products, indicating that the processing of the polycistronic mt-RNAs is normal. This finding is consistent with reports that protein–protein interactions between TEFM and RNA-processing enzymes may link transcription elongation to RNA processing (Jiang et al, 2019). To assess the steady-state transcript levels of all mt-mRNAs and mt-rRNAs, we performed deep RNA sequencing (RNA-Seq) and found similar transcript levels in WT and Polrmt-overexpressing mice (Fig 4C) despite the strong increase in de novo transcription (Fig 4A and B). Interestingly, the Polrmt-overexpressing mice showed a trend toward elevated levels of the non-polyadenyated mt-Nd6 transcript of the L-strand (Ruzzenente et al, 2012). Next, we investigated whether this discrepancy was accompanied by an imbalance in the protein levels of factors essential for posttranscriptional processes, which could explain why the increased transcription does not result in elevated steady-state levels of mt-mRNAs. We performed Western blots and label-free quantification proteomics on ultrapure mitochondria isolated from the heart, liver, and skeletal muscle. The volcano plots of the mitoproteomes of the heart, liver, and skeletal muscle show that only very few mitochondrial proteins were differentially expressed with a nominal P-value of 0.05; none of these differences were significant after multiple testing correction (Fig S6A and B). The steady-state protein levels of factors that are required for mtDNA transcription (TFAM, TEFM, TFB2M), mt-RNA processing and stability (G-rich sequence factor 1, GRSF1, LRPPRC, and SLIRP), and translation (mitochondrial ribosomal proteins MRPL37 and MRPS35) were not increased despite increased POLRMT levels (Figs 4D and S6). From the proteins involved in mtDNA gene expression or OXPHOS complex assembly, only the mitochondrial ribosomal protein, complex IV subunit COX11, and complex I assembly factor NDUFAF2 were down-regulated in the heart using nominal P-value. Thus, mouse hearts with increased POLRMT levels up-regulate mtDNA transcription (Fig 4A and B), whereas the steady-state mt-RNA levels and protein levels of other basal mtDNA gene expression machineries are not increased (Fig 4C and D).
*Polrmt overexpression increases transcription capacity.(A) Representative analysis of de novo-synthesized mitochondrial transcripts from the hearts of 14-wk-old WT (+/+) and Polrmt-overexpressing (+/T) mice. (B) Quantification of in organello synthesized mitochondrial transcripts. For each independent experiment, a +/+ and a littermate +/T were evaluated. Radioactive transcript signal intensity for +/+ and +/T was normalized to mitochondrial protein load (VDAC). The normalized +/+ signal was set to 100% and +/T is presented relative to +/+. n: 10 experiments. P < 0.05, one-sample t test (μ = 100% corresponding to the +/+ normalization). (C) RNA-Seq of mt-rRNAs and mt-mRNAs on total RNA from isolated mitochondria from hearts of 14-wk-old +/+ and +/T mice. n: 3 per genotype. (D) Western blot of factors required for mitochondrial transcription or mt-RNA processing and in +/+ and +/T mice. Loading: VDAC; n: 3–4. GRSF1 was blotted in the same blot presented in Fig 3E, so VDAC is the same in both figures.Source data are available for this figure.
Label-free quantification (LFQ) mitochondrial proteome analysis from the heart, liver, and skeletal muscle.(A) Box plots of LFQ values for +/+ and +/T mice of some selected factors involved in mitochondrial gene expression. (B) Volcano plots of mitoproteomics analysis of 52-wk-old Polrmt-overexpressing (+/T) and WT (+/+) mice. n: 5/genotype. Proteins involved in OXPHOS and mitochondrial gene expression are highlighted.
Polrmt overexpression increases 7S RNA
We next tested whether the discrepancy between the normal steady-state transcript levels and the increased transcription in the Polrmt-overexpressing mice could be explained by decreased transcript stability. We followed the relative degradation rate of de novo labeled transcripts on in organello pulse-chase assays and found no evidence of increased RNA degradation in the Polrmt-overexpressing mitochondria (Fig 5A and B). We quantified the steady-state transcript levels of mt-tRNAs, the precursor transcript mtNd5/CytB, and the most promoter-proximal transcript generated from LSP, i.e., 7S RNA (Fig 5C and D). Whereas most transcripts remained unchanged in the Polrmt-overexpressing mice, the most promoter-distal LSP transcript mt-tQ showed a mild decrease (Fig 5C and D). In contrast, we found a significant increase in 7S RNA, the most promoter-proximal LSP transcript, across all the time points analyzed in the heart (Figs 5C and D and S7) and other mouse tissues (Fig 5E). Increased levels of 7S RNA have previously been reported to correlate with increased transcription initiation (Cámara et al, 2011; Jiang et al, 2019), and our findings are therefore consistent with increased transcription initiation at LSP in the Polrmt-overexpressing mice.
*Polrmt overexpression increases LSP-promoter-proximal 7S RNA.(A) In organello synthesized mitochondrial transcripts from the hearts of 26-wk-old WT (+/+) and Polrmt-overexpressing (+/T) mice (pulse). The mRNA decay of newly synthesized transcripts was followed after 2 h (chase). Input: Western blot analysis VDAC on radiolabeled mitochondrial extracts. (B) Quantification of de novo synthesized mitochondrial transcripts normalized to VDAC and pulse signal; n: 3; grey:+/T, white:+/+. (C) Representative Northern blot analysis of mt-RNA levels in the heart of WT (+/+) and Polrmt-overexpressing (+/T) mice at different ages. (D) Quantification of mt-RNA levels from Northern blot analyses; normalization 18S rRNA; *P < 0.05; **P < 0.001; ANOVA; n: 4–6 per age. +/T and +/+ comparisons at different ages were tested within each age using a linear model with Tukey-adjusted pairwise tests. (E) Northern blot analysis of 7S RNA levels in different tissues of a +/+ and +/T 52-wk-old mouse. n: 1 per genotype.Source data are available for this figure.
Northern blot at 26 w.Northern blot analysis of mt-RNA levels in the heart of WT (+/+) and Polrmt-overexpressing (+/T) mice at 26 wk.
Co-overexpression of Lrpprc and Polrmt does not increase OXPHOS capacity
Because protein levels of the other factors involved in mt-RNA metabolism, e.g., the mRNA-binding LRPPRC/SLIRP protein complex, were unchanged in the Polrmt-overexpressing mice (Fig 4D), we hypothesized that the excess of transcripts produced cannot be stabilized. To test this hypothesis, we generated mice simultaneously overexpressing Lrpprc (Harmel et al, 2013) and Polrmt (Fig 6A). Lrpprc overexpression increased the steady-state levels of mt-mRNAs without affecting OXPHOS capacity (Fig 6B and C), consistent with our previous results (Harmel et al, 2013). However, the combined ubiquitous overexpression of Lrpprc and Polrmt did not further increase the steady-state transcript levels in comparison with Lrpprc overexpression alone, and, consistently, OXPHOS protein levels remained normal (Fig 6C). Thus, our data support that the regulatory control of OXPHOS gene expression occurs downstream of transcription initiation and transcript stabilization.
Stabilization of mitochondrial transcripts with Lrpprc overexpression does not result in a further increase of mt-RNAs in the Polrmt-overexpressing mice.(A) Western blot analysis of steady-state POLRMT and LRPPRC levels in mitochondrial extracts from the heart of WT (+/+), Lrpprc-overexpressing (Lrpprc +/T), Polrmt-overexpressing (Polrmt +/T), and Polrmt and Lrpprc double overexpressing (Polrmt +/T; Lrpprc +/T) mice. Loading: VDAC. (B) RNA-Seq of mt-rRNAs and mt-mRNAs on total RNA from hearts of 14-wk-old Lrpprc +/T, Polrmt +/T, and Polrmt +/T; Lrpprc +/T mice. Data are normalized to +/+, represented by the dotted line; n: 3 per genotype. (C) Representative Western blot of OXPHOS subunit levels in isolated mitochondria from heart at different ages; loading: VDAC. n: 3 per genotype.Source data are available for this figure.
Discussion
In this study, we generated and characterized a mouse model overexpressing Polrmt to test whether increasing POLRMT under physiologic conditions modulates OXPHOS function and its effect on health. POLRMT is an essential mitochondrial protein required to initiate mtDNA replication and to transcribe the whole mitochondrial genome (Falkenberg et al, 2024). Isolated mitochondria from the Polrmt-overexpressing mice had higher levels of de novo transcription, showing that elevated POLRMT levels can increase mitochondrial transcription initiation. Because the protein levels of the other transcription factors were not changed in the POLRMT-overexpressing mice, the detection of elevated levels of transcription suggests that a ∼50% increase in POLRMT levels alone is sufficient to increase de novo transcription. We have previously reported that in vitro transcription is activated when increasing amounts of POLRMT are added and the levels of TFAM and TFB2M are held constant (Kühl et al, 2016). Furthermore, we previously determined that the molar ratios of POLRMT are much lower than TFAM and TFB2M in mouse liver (Harmel et al, 2013). Collectively, these findings argue that POLRMT is the limiting factor for transcription initiation. However, additional experiments with recombinant in vitro transcription systems and new mouse models with inducible Polrmt expression will be necessary to further study this issue. Our data conclusively show that a moderate ∼50% increase in POLRMT levels does not affect mitochondrial OXPHOS capacity, and is not pathogenic until 52 wk of age, the latest time point that we assessed. Only a handful of mitochondrial factors have been proposed to interact with POLRMT (Miranda et al, 2022), but none of them were found to be increased in different tissues of Polrmt-overexpressing mice, showing that their expression is not affected by moderately increased POLRMT levels. This finding raises the question of why POLRMT is up-regulated under several pathogenic conditions.
Transcription initiation from LSP generates (i) a short RNA replication primer, (ii) the 7S RNA, and (iii) the full-length polycistronic transcript from the L-strand. The robust increase in 7S RNA in the Polrmt-overexpressing mice argues that transcription initiation at LSP is increased. Although the protein levels of the components of the replisome are unchanged in the Polrmt-overexpressing mice, they may be present in excess and may therefore not be limiting for mtDNA replication (Jiang et al, 2021; Misic et al, 2022). It would be interesting to co-overexpress factors of the replisome in the Polrmt-overexpressing background because TWINKLE can be loaded at the 3′ end of 7S DNA to promote full-length genomic replication and has been suggested to play a regulatory role in mtDNA replication (Milenkovic et al, 2013).
Despite the increase in de novo transcription and LSP-proximal transcripts, the steady-state levels of mature mitochondrial transcripts were surprisingly unchanged by Polrmt overexpression. Our data show that excess full-length transcripts are not produced in vivo in the Polrmt overexpressor mice. POLRMT produces two near-genomic length polycistronic transcripts that are processed and stabilized co-transcriptionally to generate the mature mt-RNAs. The stability of mt-rRNAs, mt-mRNAs, and mt-tRNAs, is mediated by different sets of nuclear-encoded proteins that are imported into the mitochondria; e.g., the LRPPRC–SLIRP complex promotes polyadenylation and stabilization of all mt-mRNAs, except mt-Nd6 (Ruzzenente et al, 2012), whereas mitochondrial ribosomal proteins and assembly factors, which are generally synthesized in excess, stabilize mt-rRNAs (Park et al, 2007; Kühl et al, 2017; Bogenhagen et al, 2018). Increased transcription can therefore lead to different expression patterns of mtDNA encoded genes depending on post-transcriptional events, as exemplified by the Lrpprc knockout mice where mt-rRNAs and mt-tRNAs are increased, but mt-mRNAs are depleted (Ruzzenente et al, 2012). None of the mt-rRNAs, mt-tRNAs, or mt-mRNAs show significantly increased steady-state levels in the Polrmt-overexpressing mice, which shows that a moderate POLRMT increase on its own does not lead to a global increase in steady-state levels of mitochondrial transcripts. Furthermore, co-overexpressing Lrpprc and Polrmt did not increase mt-mRNAs more than Lrpprc overexpression alone arguing against the hypothesis that transcripts are generated in excess and not stabilized when Polrmt is overexpressed. Although our data do not exclude that protein levels of other factors acting at later steps of mitochondrial transcript stabilization are important, we did not find evidence of decreased transcript stability using pulse-chase in organello transcription assays in isolated mitochondria.
An alternative hypothesis to explain the discrepancy between increased transcription in isolated mitochondria and the unchanged steady-state transcript levels is that different transcription scenarios are occurring in vivo compared with ex vivo isolated mitochondria. A recent in vitro study in cultured human cells has shown that the 7S RNA has a regulatory role in mitochondrial transcription by directly targeting and blocking the ability of POLRMT to initiate transcription (Zhu et al, 2022). The 7S RNA interacts with POLRMT leading to POLRMT dimerization, which sequesters essential domains for promoter recognition and unwinding. Our data are consistent with this possible mechanism, and the high levels of 7S RNA may be preventing the increased POLRMT molecules from engaging in full-length mtDNA transcription; thus, most transcripts remain unchanged under basal physiologic conditions. The increased transcription we report in the de novo transcription assays could be explained by a removal of the negative regulation of 7S RNA on mitochondrial transcription in response to the ADP-stimulated respiration conditions in which this assay is performed. This raises the question of whether the increased capacity to up-regulate mitochondrial transcription can underlie the increased exercise capacity in mice when challenged. Further experiments will be required to assess the effect on OXPHOS in these mice after exercise.
Under non-pathologic conditions, we never obtained a founder mouse with more than one additional Polrmt gene inserted into the genome despite repeated efforts, suggesting that further increases in POLRMT levels might not be tolerated in vivo. Such dose-dependent toxicity has been shown to occur in vivo with TFAM, where moderate overexpression results in increased mtDNA copy number but unaltered mtDNA expression and health-status, whereas strong overexpression results in deficient OXPHOS and early postnatal lethality (Bonekamp et al, 2021). In human cell lines, overexpression of POLRMT has been reported to have inconsistent effects. In HeLa cells, strong overexpression of POLRMT with an N-terminal HA tag did not result in increased transcripts but resulted in decreased OXPHOS protein levels (Surovtseva & Shadel, 2013). However, in non-small lung cell cancer cells, overexpression of POLRMT from a lentiviral construct (10-fold mRNA and 2-3-fold POLRMT protein level increase) resulted in a 2–3-fold increase of mature mt-mRNAs (Zhou et al, 2021). The discrepant results in cell culture experiments may be attributed to differences in the used overexpression constructs and the obtained overexpression levels, in combination with different bioenergetic demands depending on the culture conditions. Interestingly, a strong overexpression of the mitochondrial RNA polymerase (rpo41) in fission yeast increased the mitochondrial transcription capacity and led to increased steady-state levels of mitochondrial transcripts and was shown to promote the survival of yeast cells from colonies that were exposed to cold (Kelly & Lehman, 1986; Masters et al, 1987; Jiang et al, 2011). The increased exercise capacity of the Polrmt-overexpressing mice suggests that the transgenic mice can adapt faster to higher energetic demands.
POLRMT is a key factor for mtDNA expression and replication and is therefore essential for OXPHOS biogenesis in mammalian cells. Using several mouse models, we characterized the molecular consequences of ubiquitous Polrmt overexpression in different tissues. We suggest that POLRMT is the limiting factor for mtDNA transcription in vivo, but that additional regulatory steps downstream of transcription initiation and transcript stability limit OXPHOS biogenesis. Increasing POLRMT levels did not result in any pathological phenotype but led to increased exercise capacity under stress conditions. Further experiments would be required to assess the effect on OXPHOS in these mice after exercise. Our data support a model where POLRMT increases transcription initiation, allowing rapid adaptation to changed energetic demands, e.g., in response to increased exercise, or in pathogenic states such as cancer.
Materials and Methods
Generation and genotyping of transgenic Polrmt-overexpressing mice
BAC clones containing a fragment of chromosome 10, including the entire Polrmt gene, were purchased from the C57Bl/6N BAC library of DNA Bank, RIKEN BioResource Center. The BAC clone BgN01-092D16 was modified by Red/ET recombination using the counter-selection BAC modification kit (Genebridges). A silent point mutation 420G>T was introduced into exon 3 leading to a unique HindIII restriction site. Positive clones were verified by PCR followed by HindIII restriction digest, Sanger sequencing, and Southern blotting. The modified BAC was purified via a cesium chloride gradient and injected into the pronucleus of fertilized oocytes as described in Milenkovic et al (2013). Founders (+/BAC-Polrmt) were identified by PCR and restriction enzyme analysis of genomic DNA to detect gain of the HindlII site in the Polrmt gene. Tail DNA from offspring was genotyped for the presence of the BAC transgene by analyzing 100 ng of tail DNA with the GoTaq PCR reaction kit (Promega) according to the manufacturer’s instruction by adding forward primer 5′-GAGGCTCGGGTGCGGCAGCTC -3′ and reverse primer 5′-GTGCAGTGTGAGCACCTGCTGTC-3′ for PCR with an initial denaturation for 3 min at 95°C, followed by 40 cycles for 30 s at 95°C, 30 s at 60°C, and 45 s at 72°C. The reaction was ended with extension for 10 min at 72°C. Mice were maintained heterozygous on an inbred C57BL/6N background.
Ethical statement
Animals were housed in individually ventilated cages under specific pathogen–free conditions with constant temperature (21°C) and humidity (50–60%) and a 12-h light/dark cycle. All mice were fed commercial rodent chow and provided with acidified water ad libitum. Mice were euthanized by cervical dislocation. The health status of the animals is specific pathogen free according to the Federation of the European Laboratory Animal Science Association (FELASA) recommendations. All animal procedures were conducted in accordance with European, national and institutional guidelines and protocols (no.: AZ.: 84-02.05.50.15.004, AZ.: 84-02.04.2015.A103 and 84-02.04.2016.A420) were approved by the Landesamt für Natur, Umwelt und Verbraucherschutz, Nordrhein-Westfalen, Germany.
Exercise challenges and phenotyping protocol
Treadmill
Mice were placed on a treadmill (TSE Systems) for a 5-min habituation. After a 10-min warm-up phase at 0.1 m/sec, the speed was increased continuously by 0.02 m/min. If the mice did not keep up with the treadmill speed, they were exposed to a mild electric shock (0.3 mA). The distance was recorded until mice received three consecutive shocks.
Indirect calorimetry
Indirect calorimetry and home cage locomotor activity were monitored for singly housed mice in purpose-built cages (Phenomaster, TSE Systems). Parameters were measured for 48 h after at least 4 d of acclimatization. For the calculation of the respiratory exchange ratio, the volumes of consumed O_2_ and produced CO_2_ were normalized to lean body weight.
Running wheel
Voluntary running was monitored for 2 wk in individually housed mice using wireless mouse running wheels (Med Associates Inc.).
Body composition
Body fat and lean mass content were measured in vivo by nuclear magnetic resonance using the minispec LF50H (Bruker Optics).
DNA isolation, Southern blot analysis, and mtDNA quantification
For genotyping and pyrosequencing, DNA from tail or ear-clip biopsies DNA was extracted using chloroform and ethanol precipitation. For Southern blotting or qPCR, total DNA was isolated from mouse tissues using the DNeasy Blood & Tissue Kit (QIAGEN) as previously described (Kühl et al, 2016). Briefly, snap frozen tissues were ground in a cold mortar. About 20 mg of ground tissue was used to extract DNA using the blood and tissue kit or the Gentra Puregene tissue kit (QIAGEN) following the manufacturer’s instructions. All samples used for Southern blotting and qPCR were treated with RNase (QIAGEN). For Southern blot analysis, total DNA (3–10 μg) was digested with SacI endonuclease, fragments were separated by agarose gel electrophoresis, transferred to nitrocellulose membranes (Hybond-N^+^ membranes, GE Healthcare), and hybridized with alpha-^32^P-dCTP–labeled probes to detect total mtDNA (pAM1) using nuclear DNA (18S rDNA) as loading control. mtDNA was also measured by semiquantitative PCR carried out on 4 ng of total DNA in a 7900HT Real-Time PCR System (Applied Biosystems) using TaqMan probes specific for the mt-Co1, mt-Co2, mt-Cytb, mt-Nd5, mt-Nd6, and 18S genes (Applied Biosystems).
Pyrosequencing
Quantification of Polrmt gene dosage was performed on tail DNA using a PyroMark-Q24 pyrosequencer (QIAGEN). Allele quantification assay was developed using PyroMark assay design software v. 2.0 (QIAGEN). A single PCR reaction was used to amplify a 192-bp fragment spanning the c.420G>T mutation site, using a biotinylated primer ([Btn]TCTTGCTTGGCTGCAGGTAG) and a non-biotinylated primer (AGAGGCGCCAAAAGGAAGTT). PCR products were combined with distilled water, PyroMark binding buffer (QIAGEN), and 1 μl Streptavidin Sepharose high performance beads (GE Healthcare). Next, the PCR products were purified and denatured using a PyroMark Q24 vacuum workstation (QIAGEN). Sequencing was performed with PyroMark Gold Q24 reagents according the manufacturer’s instructions using the sequencing primer (CAAGATCTGGAACAAGAA). Relative allele frequencies were calculated using the PyroMark-Q24 Advance v.3.0.0 software (QIAGEN).
RT–PCR, qRT-PCR, and Northern blot analysis
RNA was isolated by using the miRNeasy Mini Kit (QIAGEN). Reverse transcription PCR (RT–PCR) was carried out after cDNA synthesis using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Real-time quantitative reverse transcription PCR (qRT-PCR) was performed using the Taqman 2x Universal PCR master mix, No Amperase UNG (Applied Biosystems). The quantity of transcripts was normalized to the TATA-binding protein (Tbp) RNA as a reference gene transcript. For Northern blotting, 1–2 μg of total RNA was denatured in RNA sample loading buffer (Sigma-Aldrich), separated on 1.2 or 1.8% formaldehyde-MOPS agarose gels before transferring onto Hybond-N^+^ membranes (GE Healthcare) overnight. After UV crosslinking, the blots were hybridized with various probes at 42°C or 65°C in RapidHyb buffer (Amersham) and thereafter washed in 2x and 0.2x SSC/0.1% SDS before exposure to film. Mitochondrial probes used for visualization of mt-mRNA and mt-rRNA levels were restriction fragments labeled with α-^32^P-dCTP and a random priming kit (Agilent). Different mitochondrial tRNAs and 7S RNA were detected using specific oligonucleotides labeled with γ-^32^P-ATP. Radioactive signals were detected by autoradiography.
De novo transcription and replication assays
In organello transcription and replication assays were performed on mitochondria isolated from mouse hearts by differential centrifugation as described before (Agaronyan et al, 2015; Kühl et al, 2016; Jiang et al, 2021; Misic et al, 2022). In organello transcription assays were carried out as previously reported (Lagouge et al, 2015). For each in organello replication assay, 1 mg of purified mitochondria were washed in 1 ml of incubation buffer (10 mM Tris, pH 7.4, 25 mM sucrose, 75 mM sorbitol, 100 mM KCl, 10 mM K_2_HPO_4_, 50 μM EDTA, 5 mM MgCl_2_, 10 mM glutamate, 2.5 mM malate, 1 mg/ml BSA, and 1 mM ADP) and resuspended in 500 μl incubation buffer supplemented with 50 μM of dCTP, dTTP, dGTP, and 20 μCi of α-^32^P-dATP (PerkinElmer) and incubated for 2 h at 37°C as reported (Matic et al, 2018). For chase experiments, radiolabeled mitochondria were washed and incubated for 2 h in incubation buffer without radioactivity. After incubation, mitochondria were washed three times in 10 mM Tris, pH 6.8, 0.15 mM MgCl_2_, and 10% glycerol. An aliquot of radiolabelled mitochondria was collected for immunoblotting with the VDAC (Millipore) or SDHA (Invitrogen) as a loading control. MtDNA was isolated by phenol/chloroform extractions or by Puregene Core Kit A (QIAGEN) and radiolabeled replicated DNA was analyzed by Southern blotting and visualized by autoradiography. Quantifications of transcript levels were performed using the program Multi Gauge with images generated from a PhospoImager instrument.
RNA sequencing
RNA was isolated from crude heart mitochondria using the miRNeasy Mini Kit (QIAGEN), and the concentration, purity, and integrity were confirmed using a BioAnalyser. RNA sequencing libraries were constructed using the Illumina TruSeq Sample Prep Kit. Paired end deep sequencing of the mitochondrial RNAs was performed on an Illumina MiSeq according to the manufacturer’s instructions. RNA-Seq was performed on mitochondrial RNA from three biological replicates of each genotype: wild-type, Polrmt-overexpressing, Lrpprc-overexpressing, and Polrmt and Lrpprc double overexpressing mice aged 14 wk. The alignment to the Mus musculus reference genome (GRCm38) was performed using HISAT2 version 2.0.5 (--dta) (Kim et al, 2019). Alignment files were sorted and indexed with SAMtools version 1.3.1 (Li et al, 2009). Transcript abundances were estimated with StringTie version 1.2.4 (−e-B) (Pertea et al, 2016) and raw reads count matrices at gene level were extracted with the included prepDE.py script on Python version 2.7.6. Differential gene expression was performed with DESeq version 1.14.1 (Love et al, 2014) after filtering of low abundance genes. Genes with an adjusted P-value < 0.05 were considered statistically significant.
Western blots and antisera
For crude mitochondria isolation, mouse tissues were homogenized using a Potter S homogenizer (Sartorius) in mitochondrial isolation buffer (320 mM sucrose, 1 mM EDTA, and 10 mM Tris–HCl, pH 7.4) containing complete protease inhibitor cocktail (Roche) followed by two rounds of differential centrifugation. Isolation of crude mitochondria from skeletal muscle was performed as previously described (Frezza et al, 2007). The protein concentration of protein samples was determined using Bradford reagent (Bio-Rad) and BSA as a standard. Proteins were separated by SDS–PAGE (using 4–12% Tris-glycine gels, Invitrogen) and then transferred onto polyvinylidene difluoride membranes (GE Healthcare) using wet tank blotting (25 mM Tris, 192 mM glycine, and 20% ethanol) at 4°C at 400 mA for 2 h or at 80 mA overnight. Immunoblotting was performed according to standard techniques using enhanced chemiluminescence (Immun-Star HRP Luminol/Enhancer from Bio-Rad). The following antibodies were used: Total OXPHOS Rodent WB Antibody Cocktail containing NDUFB8 (Complex I), SDHB (Complex II), mt-COI (CIV), UQRC2 (CIII), and ATP5A1 (CV) (ab110413; Abcam), SDHA (Invitrogen), TFAM (Abcam), VDAC (porin) from Mitoscience, and GRSF1, SSBP1, MRPL12, MRPS35, and MRPL37 from Sigma-Aldrich. Further, polyclonal antisera were used to detect TFB2M, SLIRP, LRPPRC, TWINKLE, TEFM, and POLRMT proteins (Ruzzenente et al, 2012; Milenkovic et al, 2013; Kühl et al, 2014; Lagouge et al, 2015; Jiang et al, 2019). Western blots were quantified with Fiji Image J, and each blot was normalized to the average or WT run on the same blot.
Ultrapure mitochondria isolation, peptide digestion, and cleanup for label-free mass spectrometry
Mitochondria were isolated from mouse hearts using differential centrifugation as previously reported (Kühl et al, 2016). For proteomic analysis, crude mitochondrial pellets were washed in 1xM buffer (220 mM mannitol, 70 mM sucrose, 5 mM Hepes, pH 7.4, 1 mM EGTA, pH 7.4; pH was adjusted with potassium hydroxide; supplemented with EDTA-free complete protease inhibitor cocktail and PhosSTOP Tablets [Roche]) and purified on a Percol density gradient (12%:19%:40% prepared with buffer 2xM) via centrifugation in a SW41 Ti Swinging-Bucket rotor (Beckman) at 15,500 rpm at 4°C for 1 h in a Beckman Coulter Optima L-100 XP ultracentrifuge using 14 × 89 mm Ultra-Clear centrifuge tubes (Beckman Instruments Inc.) as previously described (Kühl et al, 2017). Mitochondria were harvested at the interphase between 19% and 40%, washed three times with buffer 1xM, and the mitochondrial pellets were frozen at −80°C. Purified frozen mitochondria pellets were suspended in lysis buffer (6 M guanidinium chloride, 10 mM Tris(2-carboxyethyl)phosphine hydrochloride, 40 mM chloroacetamide, and 100 mM Tris–HCl) (Kulak et al, 2014). After complete lysis, the samples were diluted 1:10 in 20 mM Tris–HCL, pH 8.0, and 80 μg of protein was mixed with 3 μg of trypsin gold (Promega) and incubated overnight at 37°C to achieve complete digestion. The peptides were cleaned with home-made STAGEtips (Rappsilber et al, 2003) (Empore Octadecyl C18; 3 M) and eluted in 60% acetonitrile/0.1% formic acid buffer. The samples were dried in a SpeedVac apparatus (Eppendorf concentrator plus 5305) at 45°C, and the peptides were suspended with 0.1% formic acid. Approximately 1.5 μg of peptides was analyzed by LC–MS/MS.
LC–MS/MS analysis
For mass spectrometric analysis, the peptides were separated on a 25-cm, 75-μm internal diameter PicoFrit analytical column (New Objective, Part No. PF7508250) packed with 1.9 μm ReproSil-Pur 120 C18-AQ medium (Mat. No. r119.aq; Dr. Maisch) using an EASY-nLC 1000 or EASY-nLC 1200 (Thermo Fisher Scientific). The column was maintained at 50°C. Buffer A and B were 0.1% formic acid in water and 0.1% formic acid in acetonitrile, respectively. For the analysis using the EASY-nLC 1,200 system, buffer B was 80% acetonitrile, 0.1% formic acid. Peptides were separated on a segmented gradient from 2% to 5% buffer B for 10 min, from 5% to 20% buffer B for 100 min, from 20% to 25% buffer B for 10 min, and from 25% to 45% buffer B for 10 min at 200 nl/min (EASY-nLC 1,000). Using the EASY-nLC 1200 system, peptides were separated on a segmented gradient from 3% to 6% buffer B for 10 min, from 6% to 25% buffer B for 100 min, from 25% to 31% buffer B for 10 min, and from 31% to 60% buffer B for 10 min, at 200 nl/min. Eluting peptides were analyzed on a QExactive HF mass spectrometer (Thermo Fisher Scientific). Peptide precursor mass to charge ratio (m/z) measurements (MS1) were carried out at 60,000 resolution in the 300–1,800 m/z range. The top 10 most intense precursors with charge state from two to seven only were selected for HCD fragmentation using 25% collision energy. The m/z of the peptide fragments (MS2) were measured at 30,000 resolution using an AGC target of 2 × 10^5^ and 80 ms maximum injection time. Upon fragmentation, the precursors were put on an exclusion list for 45 sec. Peptides from the three different tissues were analyzed in a single run.
LC–MS/MS data analysis
The raw data were analyzed with MaxQuant version 1.4.1.2 using the integrated Andromeda search engine (Cox et al, 2011). Peptide fragmentation spectra were searched against the canonical and isoform sequences of the mouse reference proteome (proteome ID UP000000589, August 2015 from UniProt). The database was complemented with 245 sequences of contaminating proteins by MaxQuant. For the analysis methionine oxidation and protein N-terminal acetylation were set as variable modifications. The digestion parameters were set to “specific” and “Trypsin/P,” allowing for cleavage after lysine and arginine also when followed by proline. The minimum number of peptides and razor peptides for protein identification was 1; the minimum number of unique peptides was 0. Protein identification was performed at a peptide spectrum matches and protein false discovery rate (FDR) of 0.01. The “second peptide” option was on to identify co-fragmented peptides. Successful identifications were transferred between the different raw files using the “Match between runs” option, using a match time window of 0.7 min. Label-free quantification (LFQ) (Cox et al, 2014) was performed using an LFQ minimum ratio count of 2.
Protein quantification analysis
Analysis of the label-free quantification (LFQ) results was carried out using the Perseus computation platform (Tyanova et al, 2016), version 1.5.0.0 and R, version 3.3.0 (R Development Core Team, 2010). For the analysis, LFQ intensity values were loaded in Perseus and all identified proteins marked as “Reverse,” “Only identified by site,” and “Potential contaminant” were removed. The corresponding +/+ and the +/T genotypes were loaded separately in Perseus, the LFQ intensity values were log_2_ transformed and all proteins that contained less than two to five missing values in one of the groups (+/+ or +/T) were removed. Missing values in the resulting subset of proteins were imputed with a width of 0.3 and down shift of 1.8. Imputed LFQ intensities were loaded into R where a two-sided moderated t test analysis was performed using limma, version 3.30.13 (Cox et al, 2011). Proteins with an adjusted P-value (“BH” correction) of less than 0.05 were designated as differentially expressed. Our list of differentially expressed proteins was combined with the pathway annotations from MitoCarta3.0 (Rath et al, 2021).
Bioenergetic determinations
Mitochondrial oxygen consumption flux was measured at 37°C using 65–125 μg of crude mitochondria diluted in 2.1 ml of mitochondrial respiration buffer (120 mM sucrose, 50 mM KCl, 20 mM Tris–HCl, 4 mM KH_2_PO_4_, 2 mM MgCl_2_, and 1 mM EGTA, pH 7.2) in an Oxygraph-2k (Oroboros Instruments, Innsbruck, Austria). The oxygen consumption rate was measured using either 10 mM pyruvate, 10 mM glutamate, and 5 mM malate or 10 mM succinate and 10 nM rotenone. Oxygen consumption was assessed in the phosphorylating state with 1 mM ADP (state 3) or non-phosphorylating state by adding 2.5 μg/ml oligomycin (state 4). Respiration was uncoupled by successive addition of carbonyl cyanide m-chlorophenyl hydrazone (CCCP) up to 3 μM to reach maximal respiration.
To measure mitochondrial respiratory chain complex activities 15–50 μg of mitochondria were diluted in phosphate buffer (KH_2_PO_4_ 50 mM, pH 7.4), followed by spectrophotometric analysis of isolated respiratory chain complex activities at 37°C, using a Hitachi UV-3600 spectrophotometer. To follow citrate synthase activity, increase in absorbance at 412 nm was recorded after addition of acetyl-CoA (0.1 mM), oxaloacetate (0.5 mM) and DTNB (0.1 mM). Succinate dehydrogenase (SDH) activity was measured at 600 nm after the addition of 10 mM succinate, 35 μM dichlorphenolindophenol (DCPIP) and 1 mM KCN. NADH dehydrogenase activity was determined at 340 nm after the addition of 0.25 mM NADH, 0.25 mM decylubiquinone, and 1 mM KCN and controlling for rotenone sensitivity. Cytochrome c oxidase activity was measured by standard TMPD ascorbate/KCN sensitive assays. To assess the ATPase activity, 65 μg/ml frozen isolated mitochondria was incubated at 37°C in triethanolamine 75 mM, MgCl_2_ 2 mM, pH 8.9. Mitochondria were preincubated 2 min with alamethicin 10 μg/ml before addition of 2 mM of ATP. The samples were removed every 2 min and precipitated in 7% HClO_4_, 25 mM EDTA (50 μl). Phosphate was quantified by incubating an aliquot in 1 ml molybdate 5.34 mM, ferrous sulfate (28.8 mM), and H_2_SO_4_ 0.75 N for 2 min. The absorbance was assessed at 600 nm. In parallel, oligomycin (2.5 μg per ml protein) was added to the mitochondrial suspension to determine the oligomycin insensitive ATPase activity. Each activity was normalized to mg protein by using the Lowry-based Bio-Rad protein DC kit. All chemicals were obtained from Sigma-Aldrich.
Statistical analysis
Each mouse was considered an independent biological replicate (n), and repeated measurements from the same animal were treated as technical replicates. Unless otherwise indicated, ≥3 biological replicates from the transgenic mouse strain and their respective age-matched control mice were used for all experiments. Statistical analyses for RNA-Seq were performed as described above. Linear modeling was used to assess the effects of Genotype, Age, and their interaction (lm(output.variable ∼ Genotype * Age)) on Polrmt transcript levels, tissue respirometry, mitochondrial transcripts measured by Northern blot, and mtDNA levels measured by Southern blot. Estimated marginal means (EMMs) were computed using the emmeans package in R to evaluate group differences. Pairwise comparisons between genotypes were performed within each age-group using Tukey’s method to adjust for multiple comparisons. Statistical testing for POLRMT protein levels was performed using a two-sided t test. In organello experiments were analyzed using a one-sample, two-tailed t test with μ:100 as each experiment was normalized as percentage of the WT control that was run simultaneously. Statistical analyses were performed in Excel or R Studio version 1.1.383. Data visualization in R was performed using ggplot2 version 2.2.1. The definition of center and precision measures, and P-values are provided in the figure legends. P < 0.05 was considered significant.
Supplementary Material
Reviewer comments
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1Agaronyan K, Morozov YI, Anikin M, Temiakov D (2015) Mitochondrial biology. Replication-transcription switch in human mitochondria. Science 347: 548–551. 10.1126/science.aaa 098625635099 PMC 4677687 · doi ↗ · pubmed ↗
- 2Bogenhagen DF, Ostermeyer-Fay AG, Haley JD, Garcia-Diaz M (2018) Kinetics and mechanism of mammalian mitochondrial ribosome assembly. Cell Rep 22: 1935–1944. 10.1016/j.celrep.2018.01.06629444443 PMC 5855118 · doi ↗ · pubmed ↗
- 3Bonekamp NA, Peter B, Hillen HS, Felser A, Bergbrede T, Choidas A, Horn M, Unger A, Di Lucrezia R, Atanassov I, (2020) Small-molecule inhibitors of human mitochondrial DNA transcription. Nature 588: 712–716. 10.1038/s 41586-020-03048-z 33328633 · doi ↗ · pubmed ↗
- 4Bonekamp NA, Jiang M, Motori E, Garcia Villegas R, Koolmeister C, Atanassov I, Mesaros A, Park CB, Larsson N-G (2021) High levels of TFAM repress mammalian mitochondrial DNA transcription in vivo. Life Sci Alliance 4: e 202101034. 10.26508/lsa.20210103434462320 PMC 8408345 · doi ↗ · pubmed ↗
- 5Bralha FN, Liyanage SU, Hurren R, Wang X, Son MH, Fung TA, Chingcuanco FB, Tung AYW, Andreazza AC, Psarianos P, (2015) Targeting mitochondrial RNA polymerase in acute myeloid leukemia. Oncotarget 6: 37216–37228. 10.18632/oncotarget.612926484416 PMC 4741925 · doi ↗ · pubmed ↗
- 6Cámara Y, Asin-Cayuela J, Park CB, Metodiev MD, Shi Y, Ruzzenente B, Kukat C, Habermann B, Wibom R, Hultenby K, (2011) MTERF 4 regulates translation by targeting the methyltransferase NSUN 4 to the mammalian mitochondrial ribosome. Cell Metab 13: 527–539. 10.1016/j.cmet.2011.04.00221531335 · doi ↗ · pubmed ↗
- 7Chaudhary S, Ganguly S, Palanichamy JK, Singh A, Bakhshi R, Jain A, Chopra A, Bakhshi S (2021) PGC 1A driven enhanced mitochondrial DNA copy number predicts outcome in pediatric acute myeloid leukemia. Mitochondrion 58: 246–254. 10.1016/j.mito.2021.03.01333812061 · doi ↗ · pubmed ↗
- 8Cox J, Michalski A, Mann M (2011) Software lock mass by two-dimensional minimization of peptide mass errors. J Am Soc Mass Spectrom 22: 1373–1380. 10.1007/s 13361-011-0142-821953191 PMC 3231580 · doi ↗ · pubmed ↗
