# Dataset of the complete mitogenomes of the mushroom corals Fungiidae

**Authors:** Liwei Li, Zhangwang Lu, Zhiwei Liu, Cheng Liang, Jun Wang, Yan Wang

PMC · DOI: 10.1016/j.dib.2025.111857 · Data in Brief · 2025-07-08

## TL;DR

This paper presents a dataset of 24 complete mitochondrial genomes from mushroom corals, revealing insights into their genetic diversity and evolutionary relationships.

## Contribution

The study provides a comprehensive mitogenome dataset for Fungiidae corals and identifies minisatellite sequences in intergenic regions.

## Key findings

- Fungiidae mitogenomes share the same 13 protein-coding genes and two rRNA genes as other corals.
- Intergenic regions show high diversity, with minisatellites found in specific regions of most mitogenomes.
- Phylogenetic trees using mitogenome data offer higher resolution for genus- and species-level relationships.

## Abstract

Twenty-four mitogenomes of the mushroom corals (Fungiidae), representing 18 species from 12 genera, were sequenced and annotated. These mitogenomes exhibit high similarity, each containing the same 13 protein-coding genes (PCGs) and two rRNA genes as other scleractinian corals. Compared to the genes, the intergenic regions (IGRs) are more diverse. Interestingly, minisatellite sequences were identified in the IGRs between COX1 and trnM (IGRCOX1-trnM) and between ND4 and rrnS (IGRND4-rrnS) of most Fungiidae mitogenomes. Primarily due to the existence of minisatellites in IGRCOX1-trnM, the length of Fungiidae mitogenomes varies from 16,292 to 17,399 bp. Similar to the phylogenetic tree based on partial COI sequences, Bayesian phylogenetic trees constructed using 13 PCGs, IGRCOX1-trnM and IGRND4-rrnS divide Fungiidae into four distinct clades. However, the latter three trees provide a higher resolution of genus- and species-level evolutionary relationships. This mitogenome dataset will be valuable for better understanding the phylogeny of Fungiidae. The diverse IGRs in these mitogenomes may serve as a useful resource for developing Fungiidae DNA barcodes, while the identified minisatellites can facilitate studies on the population biology of Fungiidae.

## Linked entities

- **Genes:** COX1 (cytochrome c oxidase subunit I) [NCBI Gene 4512], TRNM (tRNA-Met) [NCBI Gene 4569], ND4 (NADH dehydrogenase subunit 4) [NCBI Gene 4538], rrnS (16S ribosomal RNA) [NCBI Gene 2716956]
- **Species:** Fungiidae (taxon 46711)

## Full-text entities

- **Genes:** TRNM (tRNA-Met) [NCBI Gene 4569] {aka MTTM}, COX1 (cytochrome c oxidase subunit I) [NCBI Gene 4512] {aka COI, MTCO1}, ND4 (NADH dehydrogenase subunit 4) [NCBI Gene 4538] {aka MTND4}
- **Species:** Lithophyllon scabra (species) [taxon 1911065], Lithophyllon undulatum (species) [taxon 486206], Sandalolitha robusta (species) [taxon 51068], Danafungia horrida (species) [taxon 486202], Cycloseris costulata (species) [taxon 486194], Fungiidae (mushroom corals, family) [taxon 46711], Psammocora nierstraszi (species) [taxon 371654], Anthozoa (anthozoans, class) [taxon 6101], Homo sapiens (human, species) [taxon 9606]
- **Mutations:** GTAAAAAAGCAGGTAGCCATCCTGGAAACAGGTAG)2(AAAAAGCAGGTAGCCATCCTGGAAACAGGTAGGTAGCCATCCTGGAAACAGGTAGGT, AGAGTGTGAGAAAGATTTAAAGACAAAAACATCAGATACGGAGAA)2(ATTTAATGAAAAAGAGTGTGAAATAG, A18S

## Full text

_Full body text omitted from this summary view._ Fetch the complete paper as Markdown: https://tomesphere.com/paper/PMC12311936/full.md

## Figures

3 figures with captions in the complete paper: https://tomesphere.com/paper/PMC12311936/full.md

## References

26 references — full list in the complete paper: https://tomesphere.com/paper/PMC12311936/full.md

---
Source: https://tomesphere.com/paper/PMC12311936