Correction: Achilla et al. Genetic and Epigenetic Association of FOXP3 with Papillary Thyroid Cancer Predisposition. Int. J. Mol. Sci. 2024, 25, 7161
Charoula Achilla, Angeliki Chorti, Theodosios Papavramidis, Lefteris Angelis, Anthoula Chatzikyriakidou
Abstract
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsRNA modifications and cancer
In the original publication, there was a mistake in Table 3 as published [1]. The presented forward primer for the COBRA analysis was not the correct one used. The correct one is “F: TTTTTTATTTTTTGGGTTTTTG”. The scientific conclusions remain unaffected by this correction. The Academic Editor approved this correction. The original publication has also been updated. The corrected Table 3 and legend appear below.
The reference list from the paper itself. Each links out to its DOI / PubMed record.