Phytochemical Characterization and Potential Anti‐Oxidative Activity of Lavandula angustifolia subsp. pyrenaica (DC.), Lavandula x intermedia Emeric ex Loisel cv Grosso, and cv Super Essential Oils Compared to a Commercial Lavender Essential Oil
Eileen Mac Sweeney, Ylenia Pieracci, Vlad Sebastian Popescu, Gianluca Angius, Guido Flamini, Luisa Pistelli, Giulia Abate, Andrea Mastinu

TL;DR
This study compares the chemical makeup and antioxidant effects of lavender essential oils from different sources, finding that natural oils protect cells better than a commercial product.
Contribution
The study reveals that naturally derived lavender essential oils have superior antioxidant properties and gene expression effects compared to commercial variants.
Findings
Hydrodistilled lavender essential oils showed significant protection against oxidative stress in human neuroblastoma cells.
Commercial essential oil lacked protective effects and contained additives not found in natural oils.
Grosso and Super LEOs upregulated antioxidant-related genes in treated cells.
Abstract
This study investigates the phytochemical profiles and antioxidant properties of three lavender essential oils (LEOs) from Lavandula angustifolia subsp. pyrenaica (DC.), Lavandula x intermedia Emeric ex Loisel cv Grosso, and Lavandula x intermedia Emeric ex Loisel cv Super, and compares them to a commercial one. LEOs were extracted by hydrodistillation, analyzed using gas chromatography‐mass spectrometry, and tested for antioxidant effects on human SH‐SY5Y neuroblastoma cells. The major components identified in all the four LEOs were linalool and linalyl acetate; however, in the commercial LEO differences in minor compounds and the presence of additives were found. Antioxidant activity assays revealed significant protection against H₂O₂‐induced oxidative stress for hydrodistilled EOs, while the commercial EO showed no protective effect. Gene expression analysis indicated upregulation of…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
FIGURE 1
FIGURE 2
FIGURE 3| Relative abundance (%) ± Standard deviation | ||||||
|---|---|---|---|---|---|---|
| Compounds | Class |
Linear Retention index |
|
|
| Commercially available LEO |
| α‐pinene | mh | 933 | 0.2 ± 0.00 | 0.3 ± 0.01 | 0.5 ± 0.16 | — |
| Camphene | mh | 948 | 0.2 ± 0.00 | 0.2 ± 0.01 | 0.3 ± 0.11 | — |
| 1‐octen‐3‐ol | nt | 976 | — | — | — | 0.2 ± 0.01 |
| β‐pinene | mh | 977 | 0.2 ± 0.01 | 0.3 ± 0.01 | 0.4 ± 0.17 | — |
| 3‐octanone | nt | 985 | 0.2 ± 0.04 | — | — | 0.2 ± 0.00 |
| Myrcene | mh | 991 | 0.5 ± 0.00 | 0.4 ± 0.01 | 0.5 ± 0.15 | 0.2 ± 0.00 |
| δ‐3‐carene | mh | 1011 | 0.1 ± 0.01 | — | — | 0.2 ± 0.00 |
| 1‐hexyl acetate | nt | 1012 | 0.3 ± 0.02 | 0.2 ± 0.02 | — | — |
| p‐cymene | mh | 1024 | 0.1 ± 0.01 | — | 0.2 ± 0.23 | — |
| Limonene | mh | 1029 | 0.5 ± 0.01 | 0.5 ± 0.04 | 0.7 ± 0.09 | 0.4 ± 0.03 |
| 1,8‐cineole | om | 1031 | 1.6 ± 0.09 | 3.9 ± 0.05 | 6.2 ± 1.46 | 4.3 ± 0.11 |
| (Z)‐β‐ocimene | mh | 1036 | 2.0 ± 0.22 | 0.5 ± 0.01 | 0.8 ± 0.36 | 1 ± 0.04 |
| (E)‐β‐ocimene | mh | 1047 | 2.1 ± 0.09 | 0.5 ± 0.04 | 0.3 ± 0.10 | 0.3 ± 0.00 |
| γ‐terpinene | mh | 1058 | — | — | 0.4 ± 0.11 | — |
|
| om | 1072 | 0.2 ± 0.03 | 0.1 ± 0.00 | — | — |
| Terpinolene | mh | 1089 | 0.3 ± 0.03 | 0.3 ± 0.00 | 12.7 ± 12.41 | — |
| Linalool | om | 1101 | 21.8 ± 1.15 | 27.0 ± 0.42 | 19.6 ± 9.45 | 28.6 ± 0.58 |
| 1‐octen‐3‐yl acetate | nt | 1113 | 0.5 ± 0.05 | 0.1 ± 0.01 | — | 0.3 ± 0.01 |
|
| om | 1122 | — | — | — | 0.2 ± 0.01 |
| 2‐p‐Menthen‐1‐ol | om | 1126 | — | — | — | 0.3 ± 0.01 |
| Camphor | om | 1145 | 0.5 ± 0.04 | 6.4 ± 0.05 | 5.9 ± 1.89 | 4.4 ± 0.02 |
| Hexyl isobutyrate | nt | 1149 | — | 0.2 ± 0.03 | — | — |
| Isoborneol | om | 1157 | — | — | — | 1.9 ± 0.03 |
| Borneol | om | 1165 | 2.1 ± 0.22 | 4.7 ± 0.11 | 3.3 ± 0.97 | 4.7 ± 0.04 |
| Lavandulol | om | 1166 | 0.8 ± 0.1 | — | — | — |
| 4‐terpineol | om | 1177 | 4.4 ± 0.36 | 4.3 ± 0.12 | 3.6 ± 0.44 | 0.2 ± 0.00 |
| Cryptone | om | 1186 | 0.5 ± 0.02 | — | — | 0.1 ± 0.00 |
| α‐terpineol | om | 1191 | 4.9 ± 0.18 | 3.7 ± 0.34 | 2.6 ± 2.20 | 1.7 ± 0.02 |
| Hexyl butyrate | nt | 1193 | — | — | — | 0.4 ± 0.01 |
| Nerol | om | 1228 | 0.7 ± 0.08 | 0.5 ± 0.00 | 0.7 ± 0.23 | — |
| Cumin aldehyde | om | 1239 | 0.1 ± 0.01 | — | — | — |
| Geraniol | om | 1254 | 1.9 ± 0.23 | 1.3 ± 0.17 | 9.5 ± 6.72 | — |
| Linalyl acetate | om | 1257 | 20.1 ± 0.24 | 19.1 ± 0.23 | 10.2 ± 5.36 | 36.1 ± 0.03 |
| Bornyl acetate | om | 1286 | 0.2 ± 0.04 | — | — | — |
| Lavandulyl acetate | om | 1292 | 6.4 ± 0.28 | 3.0 ± 0.11 | 2.7 ± 1.69 | 2.9 ± 0.04 |
| Hexyl tiglate | nt | 1332 | — | 0.3 ± 0.05 | — | — |
| Neryl acetate | om | 1365 | 1.5 ± 0.04 | 1.1 ± 0.00 | 1.6 ± 0.64 | 0.3 ± 0.01 |
| Geranyl acetate | om | 1385 | 3.1 ± 0.13 | 2.5 ± 0.09 | 2.1 ± 0.10 | 1.5 ± 0.07 |
| β‐caryophyllene | sh | 1419 | 5.5 ± 0.10 | 1.4 ± 0.07 | 0.6 ± 0.49 | 7.2 ± 0.37 |
|
| sh | 1436 | — | — | — | 0.2 ± 0.00 |
| α‐humulene | sh | 1453 | 0.2 ± 0.01 | — | — | — |
| (E)‐β‐farnesene | sh | 1458 | 1.1 ± 0.04 | 0.9 ± 0.01 | 0.5 ± 0.12 | 0.5 ± 0.03 |
| Lavandulyl butyrate | om | 1460 | — | — | 0.1 ± 0.02 | — |
| Germacrene D | sh | 1481 | 0.5 ± 0.07 | 0.7 ± 0.00 | 0.7 ± 0.20 | 0.3 ± 0.02 |
| Lavandulyl isovalerate | om | 1508 | — | 0.4 ± 0.01 | 0.4 ± 0.05 | — |
|
| sh | 1514 | 0.7 ± 0.04 | — | 0.5 ± 0.13 | 0.3 ± 0.04 |
| Caryophyllene oxide | os | 1582 | 5.3 ± 0.62 | 0.4 ± 0.01 | 0.5 ± 0.09 | 0.4 ± 0.05 |
| 1,10‐di‐epi‐cubenol | os | 1615 | 0.4 ± 0.00 | — | 0.3 ± 0.01 | — |
| T‐cadinol | os | 1641 | 6.8 ± 0.41 | 2.2 ± 0.10 | 3.4 ± 0.16 | 0.3 ± 0.03 |
| α‐Cadinol | os | 1654 | — | — | 0.1 ± 0.02 | — |
| 14‐hydroxy‐9‐epi‐(E)‐caryophyllene | os | 1670 | 0.3 ± 0.04 | — | — | — |
| α‐bisabolol | os | 1685 | — | 11.5 ± 0.21 | 7.3 ± 1.03 | — |
|
| os | 1686 | 0.5 ± 0.02 | — | — | — |
| (Z,E)‐farnesol | os | 1689 | — | 0.5 ± 0.04 | 0.4 ± 0.03 | — |
| Benzyl benzoate | nt | 1763 | 0.1 ± 0.01 | — | — | — |
| Total identified (%) | 98.9 | 99.9 | 99.9 | 99.3 | ||
| Oxygenated monoterpenes | 71.0 | 78.2 | 68.7 | 87.1 | ||
| Sesquiterpenes hydrocarbons | 7.9 | 2.9 | 2.4 | 8.4 | ||
| Monoterpenes hydrocarbons | 5.7 | 2.9 | 16.9 | 2.0 | ||
| Oxygenated sesquiterpene | 13.3 | 14.5 | 11.9 | 0.7 | ||
| Non‐terpene derivatives | 1.0 | 1.4 | — | 1.1 | ||
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsEssential Oils and Antimicrobial Activity · Phytochemicals and Antioxidant Activities · Phytochemistry and Biological Activities
Introduction
1
Lavandula L. genus, commonly known as lavender, belongs to the Lamiaceae family [1] and includes 39 species as well as hundreds of cultivars and hybrids [2, 3, 4]. Plants belonging to this genus consist mostly of small perennial shrubs; Lavandula species can differ in height, color, and shape of their leaves, flowering period, natural habitat, geographical distribution, and essential oils (EOs) composition [4, 5, 6, 7]. Lavender plants commonly reach a height of 30–80 cm [2] and grow in rocky and sunny habitats. They are characterized by linear and semievergreen leaves, presenting a grey‐green color in summer, and becoming silvery during the winter [7]. Lavender plants also exhibit purple flowers, distributed in spike shapes at the end of long stalks [2]. Lavandula genus plants are native to the Mediterranean area, including Northern Africa, Turkey, France, Spain, and Italy; in addition, they can also be found in the Canary Islands, Southern Africa, England, India, Australia, and the USA [5, 6, 7]. The most researched and known Lavandula species are Lavandula angustifolia Miller, also known as Lavanda vera or Lavanda officinalis, Lavandula stoechas L. (French lavender) [6], and Lavandula latifolia, commonly known as spike lavender [4, 5, 6, 7]. L. x intermedia (lavandin), is a hybrid cross between two natural‐growing lavenders, L. latifolia and L. angustifolia [4, 5, 6, 7]. L. angustifolia subsp. pyrenaica (DC.) and two different cultivars of lavandin, namely lavandin Emeric ex Loisel cv Grosso and lavandin Emeric ex Loisel cv Super, are the focus of this research. L. angustifolia is a hardy perennial plant, that can reach a height of 50 cm; this plant is characterized by narrow and linear grey leaves that become greener as they mature, with blue, white, and violet flowers. It can be found mainly in mountainous regions in Italy, France, and Spain at 600–1200 m above sea level, in sunny and drained calcareous soils [5, 7]. L. latifolia height can vary from 50 to 100 cm; the leaves are grey and silvery in color and linear to spathulate in shape, with blue to pale purple‐colored flowers; L. latifolia has a similar distribution to that of L. angustifolia, differing only for the altitude (300 m above sea level) [5, 7]. L. “Grosso” and L. “Super”, as hybrid plants derived from L. angustifolia and L. latifolia, grow in the territories the parents naturally habit; these shrubs can reach heights of 60 –150 cm and are characterized by purple to white flowers and grey leaves with shape from linear to spathulate [5]. A noteworthy feature of L. intermedia, and hybrid plants in general, is hybrid vigor (also known as heterosis), which means that they exhibit some added emerging benefits compared to their parent plants. In the case of the lavandin subspecies, they are sturdier than true lavender and they contain a higher amount of EOs thanks to their secretory structures being more present than the ones of true lavender [7, 8, 9]. All these characteristics render lavandin cultivars easier and cheaper to cultivate and more profitable as they give more EOs per hectare compared to L. angustifolia and other natural lavenders, making them ideal for commercial uses. However, since L. intermedia is a cross‐hybrid, is considered sterile [4, 5, 6, 7]. Lavender plants share similar ethnobotanical properties and the main EOs compounds are conserved throughout the whole genus [4, 5, 6, 7]. Since the Middle Ages, lavender and its extracts have been used in the perfume industry, for aromatherapy, skincare, sleep aid, and washing clothes [10, 11]. Other traditional uses include the treatment of respiratory disorders, such as cough, cold, asthma, and sinus congestion [10, 11]. Lavender EOs have been proven to have many pharmacological applications, including anti‐inflammatory and antioxidant properties, along with antimicrobial, antifungal, and antiviral activity [11, 12, 13, 14, 15].
To the best of our knowledge, only a few studies have compared different Lavandula species with each other, especially considering L. intermedia cultivars. The main objective of this research is to analyze the phytochemical profile of three different lavender EOs (LEOs) (L. angustifolia, L. “Grosso”, and L. “Super”) and to characterize them from a biological point of view while comparing them to a commercially available LEO.
The three LEOs were obtained by hydrodistillation, and their phytochemical content was analyzed by means of gas chromatography‐mass spectrometry (GS‐MS) analysis. The antioxidant activity was evaluated using a human neuroblastoma cell line (SH‐SY5Y).
Results
2
LEOs' Phytochemical Profile
2.1
The LEOs' chemical composition was analyzed by means of GC‐MS. Specifically, for L. angustifolia, the main compounds found were linalool (21.8%) and linalyl acetate (20.1%) (Table 1), belonging to oxygenated monoterpenes, which interestingly represented the most abundant class of compounds found in this EO (71%), followed by oxygenated sesquiterpenes (13.3%), sesquiterpene hydrocarbons (7.9%), monoterpene hydrocarbons (5.7%), and other non‐terpene derivatives (1%) (Table 1).
Linalool (27%) and linalyl acetate (19.1%) were, also, the major components of L. “Grosso” EO (Table 1), and even in this case, the major detected class of compounds was oxygenated monoterpenes, representing 78.2%, besides oxygenated sesquiterpenes (13.3%), sesquiterpene hydrocarbons (7.9%), monoterpene hydrocarbons (5.7%), and other non‐terpene derivatives (1%) (Table 1).
Interestingly, the chemical profile of L. “Super” EO showed that the main components were the oxygenated monoterpenes linalool (19.6%) and linalyl acetate (10.2%), and the monoterpene hydrocarbon terpinolene (12.7%) (Table 1). The main class of components was, also in this case, oxygenated monoterpenes, accounting for 68.7%; unlike the previously described EOs, monoterpene hydrocarbons were the second class, representing 16.9%, followed by oxygenated sesquiterpenes (11.9%), and sesquiterpene hydrocarbons (2.4%), (Table 1).
Finally, the chemical composition of the commercially available LEO was analyzed. The main compounds were linalyl acetate (36.1%) and linalool (28.6%) (Table 1). Interestingly, compounds like 2‐p‐menthen‐1‐ol, cis‐p‐menth‐2‐en‐1‐ol, and 1‐octen‐3‐ol, not present in the previous three LEOs, were also identified. Once again, oxygenated monoterpenes represented the great majority of the chemical composition (87.1%), followed by sesquiterpene hydrocarbons (8.4%), monoterpene hydrocarbons (2%), other non‐terpene derivatives (1.1%), oxygenated sesquiterpenes (0.7%), and phenylpropanoids (0.5%) (Table 1).
LEOs Cytocompatibility
2.2
The cytocompatibility of L. angustifolia, L. “Grosso”, L. “Super” EOs, and the commercially available LEO was established on the SH‐SY5Y cell line by performing a 3‐[4,5‐dimethylthiazol‐2‐yl]‐2,5‐diphenyl‐tetrazolium bromide (MTT) assay. Cells were treated with the four LEOs at concentrations ranging from 0.0001% to 0.2% for 48 h. Treatments were considered cytotoxic if they reduced cell viability by more than 80%. As shown in Figures 1A,B, the treatment with L. angustifolia and L. “Grosso” EOs resulted to be cytotoxic at concentrations above 0.1%; considering L. EO, only the treatment with the 0.2% concentration significantly reduced cell viability below 80% (Figure 1C). No cytotoxicity was detected for the treatment with the commercially available LEO (Figure 1D).
SH‐SY5Y cell line viability after treatment with L. angustifolia essential oil (A); L. “Grosso” essential oil (B); L. “Super” essential oil (C); commercial lavender essential oil (D). Data are presented as a percentage of cell viability compared to untreated cells used as a control. The red dotted line indicates the percentage of cell viability under which the treatments were considered cytotoxic. Data are shown as mean ± SEM of three replicates: # p < 0.05 versus the control group.
LEOs Anti‐Oxidative Potential
2.3
In order to test the anti‐oxidative potential of the three hydrodistilled LEOs and to compare them with the commercial LEO, the SH‐SY5Y cell line was initially exposed to each of the four LEOs at concentrations ranging from 0.0001% to 0.2%, for 24 h. Subsequently, cells were treated with H₂O₂ 0.2 mM, used as an anoxidative stimulus. After a further 24 h, cell viability was determined by means of an MTT assay. Pre‐treatment with L. angustifolia (Figure 2A), L. “Grosso” (Figure 2B), and L. “Super” (Figure 2C) EOs at concentrations ranging from 0.0001% to 0.01% was able to significantly increase cell survival compared to the H_2_O_2_ treated group. Interestingly, the commercial LEO did not show a significant protective effect against the H_2_O_2_‐induced oxidative stress at any concentration (Figure 2D).
*The anti‐oxidative potential of L. angustifolia essential oil (A), L. “Grosso” essential oil (B), L. “Super” essential oil (C), and commercial lavender essential oil (D) on SH‐SY5Y exposed to H2O2, as an oxidative stimulus. Data are presented as a percentage of cell viability compared to untreated cells used as a control. The red dotted line indicates the percentage of cell viability under which the treatments were considered cytotoxic. Data are shown as mean ± SEM of three replicates: p < 0.05 vs H2O2; # p < 0.05 vs. control group.
To deepen the understanding of the oxidative protection mechanism, SH‐SY5Y cells were treated with L. “Grosso” and L. “Super” EOs at 0.0001%, the lowest dose that resulted in protection against the H_2_O_2_ insult, for 12 h. The expression levels of two genes with antioxidant functions, namely NQO1 and CYT B, were assessed. This setup reflects the cellular conditions after the treatment with the LEOs and prior to H₂O₂ exposure, providing insight into how the EOs prime the cells for oxidative stress defense. As depicted in Figure 3, NQO1 and CYT B genes were not expressed in untreated cells, whereas treatment with 0.0001% L. “Super” and L. “Grosso” EOs resulted in a significant upregulation of both NQO1 (Figure 3A) and CYT B (Figure 3B). Additionally, L. “Super” demonstrated a more pronounced effect compared to L. “Grosso”.
*L. “Grosso” and L. “Super” essential oils increased the expression of two genes involved in antioxidant protection, NQO1 (A) and CYT B (B). SH‐SY5Y cells were treated with 0.0001% L. “Grosso” and L. “Super” essential oils for 12 h. The NQO1 and CYT B mRNA expression levels were then determined by real‐time polymerase chain reaction (PCR). glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) was used as a normalizer. Data are representative of three replicates and shown as mean ± SEM; *p < 0.05; **p < 0.01; **p < 0.001 versus control.
Discussion
3
L. angustifolia, L. “Grosso”, and L. “Super” are plants belonging to the Lavandula L. genus and are mainly distributed in the Mediterranean area [16]. LEOs are characterized by unique aroma and therapeutic properties, including antimicrobial, anti‐inflammatory, and antioxidant abilities. Considering these aspects, lavender extracts and EOs have been used in traditional medicine since the Middle Ages [17]. Nowadays, given their wide range of uses, many LEOs are commercially available worldwide; however, their composition and properties, which can be influenced by their production, are not always assessed. In this study, three LEOs derived from L. angustifolia, L. “Grosso”, and L. “Super”, obtained by hydrodistillation, as well as a commercially available LEO, were compared for their phytochemical composition and biological properties. The chemical profiles of the three LEOs extracted via hydrodistillation resulted to be similar to the commercially available LEO in terms of main constituents; linalool and linalyl acetate represented the main identified compounds, in accordance also with the literature [18], while oxygenated monoterpenes were the prevalent class of compounds [11, 19–21]. Although the commercial LEO was characterized by a higher content of linalyl acetate, linalool, and beta‐caryophyllene compared to the ones obtained through hydrodistillation, it showed reduced levels of α‐terpineol and 4‐terpineol and the total absence of terpinolene and α‐pinene. These compounds are known to be biologically active; specifically, α‐terpineol has been shown to have anti‐inflammatory properties [22], while terpinolene has antioxidant activity [23]; α‐pinene and 4‐terpineol are characterized by anti‐inflammatory and antioxidant properties [24, 25, 26]. This synergistic effect among the various molecules present in EOs has been extensively studied in the literature [27]. Findings indicate that the overall effect is attributed to the entire phytocomplex and that even molecules present in small amounts play a significant role in biological activity [28]. This concept of the phytocomplex [29] helps explain why commercial EO, despite being rich in major components such as linalool and linalyl acetate, does not exhibit the same biological activity observed in hydrodistilled EOs.
Furthermore, it is worth mentioning that in the commercial LEO were detected traces of chemicals not found in any of the other three LEOs, like 2‐p‐menthen‐1‐ol, cis‐p‐menth‐2‐en‐1‐ol, and 1‐octen‐3‐ol. Among these molecules, only 1‐octen‐3‐ol has been reported in the literature and it has been associated with pro‐inflammatory effects and target mitochondria, with alterations in the bioenergetic and in the levels of antioxidant enzymes in Drosophila melanogaster [30, 31].
To evaluate their antioxidant effect, the four LEOs were tested in vitro on a human neuroblastoma cell line (SH‐SY5Y) at concentrations ranging from 0.0001% and 0.2%. The LEOs obtained through hydrodistillation did not show any cytotoxic effect, except at the highest concentrations. The commercial LEO did not reduce cell viability at any of the considered concentrations, as well. Regarding the antioxidant properties of the EOs, the hydrodistilled LEOs had a significant protective effect against the H_2_O_2_‐induced oxidative stimulus at concentrations ranging from 0.0001% to 0.01%.
However, the commercially available LEO did not show a protective effect at any of the used dosages. To have an in‐depth understanding of the antioxidant properties of the four LEOs, the expression levels of NQO1, involved in oxidative protection [32], and CYT B, a component of respiratory chain complex III [33], were evaluated in the SH‐SY5Y cell line after a 12‐h exposure to 0.0001% L. “Grosso” and L. “Super” EOs. These EOs were selected based on their low cytotoxicity and because only a few studies present in the literature focus on them. The results showed that both EOs significantly increased the expression levels of both genes compared to the non‐treated control, with L. “Super” outperforming L. “Grosso”. The results of the antioxidant activities obtained are congruent with other studies, which show L. angustifolia, L. “Grosso”, and L. “Super” extracts to have a significant scavenger‐like effect against free radicals, as tested with different chemical assays [5, 12, 34].
Several studies have also emphasized the antioxidant potential of L. angustifolia and lavandin EOs, demonstrating that their activity is influenced by variations in chemical composition as well as environmental factors, including soil composition, pH, and geographic location [35]. Specifically, Gavrić et al. [36] and Détár et al. [37] demonstrate that the antioxidant capacity of L. angustifolia and lavandin EOs can vary depending on the cultivar and the content of metabolites, such as flavonoids and, more broadly, phenolic compounds.
In conclusion, the EOs of L. angustifolia, L. “Grosso”, and L. “Super” all showed to have significant protection against oxidative stress caused by the H_2_O_2_ treatment; since the main compounds found in LEOs are known for their antioxidant properties [38, 39], the effect previously mentioned could be attribute to the cooperative synergistic effects of the chemical compounds in the EOs, as also reported in the literature [40]. The ratios and interactions of the compounds enable them to act as scavengers, intercepting free radicals. However, this ability is absent in the commercially purchased LEO, which showed no protective effects at any of the tested concentrations. This lack of activity could be attributed to the different composition of the EO, as evidenced by the GS‐MS results. We hypothesize that decreased levels of α‐terpineol and 4‐terpineol, the absence of terpinolene and α‐pinene, as well as the presence of additive compounds influence the antioxidant effects of the mixture, as also reported by Hosseini et al. [41]. These chemicals that are added during the manufacturing process can improve and exalt the fragrance of the EO, as well as its conservation for longer periods of time at the expense of their biological activities and natural genuineness, resulting in the sophistication of the product.
Materials and Methods
4
Plant Materials and EOs
4.1
L. angustifolia, L. “Grosso”, and L. “Super” EOs were kindly provided by the University of Pisa. The EOs were obtained from plants cultivated during the summer of 2018 in Tuscany (Bibbona, Livorno, Italy; 43°27′N. 10°58′E. 60 m a.s.l). The commercially available EO is made by the “VicTsing” company and was bought by an online retailer. A sample of each EO was preserved and cataloged at the Department of Molecular and Translational Medicine, Division of Pharmacology, University of Brescia.
Hydrodistillation
4.2
To obtain the EOs, 50 g of air‐dried aerial parts of each lavender were hydrodistilled by a Clevenger‐type apparatus for 2 h, as reported in the European Pharmacopoeia. The extracted oils were then conserved at 4°C and maintained far from any light sources until analyses.
GC‐MS Analysis
4.3
The chemical analysis was performed, in triplicates, by GC‐MS on EOs diluted to 5% with HPLC‐grade n‐hexane. The GC‐MS analysis was carried out with an Agilent 7890B gas chromatograph paired with an Agilent 5977B single quadrupole mass detector (Agilent Technologies, Inc., Santa Clara, CA) furnished with an Agilent HP‐5MS capillary column (30m x 0,25 mm; coating thickness 0,25 µm).
The analytical conditions were set as follows: the injector and transfer line temperatures at 220 and 240°C, respectively, oven temperature progression from 60 to 240°C at a 3°C/min rate, helium as carrier gas flowing at 1 mL/min with a split ratio of 1:25. The acquisition operated in full scan mode within the range of 30–300 m/z at 1,0 second scan time. The compound identification was based on the comparison of the sample's retention time and indices with authenticated samples and a series of n‐hydrocarbons. Additionally, computer‐assisted matching was used against both commercial [42] and lab‐developed mass spectra libraries, comprised of pure substances, known EO constituents, and MS literature data [43, 44, 45, 46].
Cell Culture and Treatments
4.4
The SH‐SY5Y cell line (human neuroblastoma cells) was cultured in cell culture medium composed of DMEM and Ham's F12 medium 1:1, supplemented with 10% fetal bovine serum, 0.5% L‐glutamine, 100 U/mL penicillin and 100 µg/mL streptomycin, at 37°C and 5% CO_2_. Cells were seeded at a density of 2 × 10^4^ cells/well in 96‐well plates. For the cytotoxicity test, cells were treated with the four LEOs at different concentrations (0.2%, 0.1%, 0.01%, 0.001%, and 0.0001%) for 48 h. Untreated cells were used as control.
The antioxidant activity was then tested by treating SH‐SY5Y cells with the four LEOs at the concentrations previously used for 24 h; cells were then exposed to the oxidant stimulus H_2_O_2_ 0.2 mM for a further 24 h. Untreated cells and cells treated solely with H_2_O_2_ 0.2 mM were used as controls.
Cell Viability
4.5
After the treatments, the viability was assessed by incubating SH‐SY5Y cells with 500 mg/mL of MTT for 90 min at 37°C; they were then lysed with DMSO and the absorbance was measured at 570 nm using an EnSight Multi‐mode Plate Reader (PerkinElmer, Waltham, MA, USA).
Data were expressed as a percentage of cell viability over the control group. The results were expressed as mean ± SEM.
Quantitative Real‐Time Polymerase Chain Reaction
4.6
To deepen the antioxidant potential of the two more promising LEOs, SH‐SY5Y cells were treated with L. “Grosso” and L. “Super” EOs at 0.0001% for 12 h. The expression of two genes involved in cellular protection against ROS, namely NQO1 (NAD(P)H quinone dehydrogenase 1) and CYT B (cytochrome B), was then evaluated. Specifically, cells were seeded at a density of 9 × 10^4^ cells/well in 24‐well plates, and total RNA was extracted following the TRIzol reagent protocol. Subsequently, 2 µg of total mRNA were reverse‐transcribed using a reaction mix consisting of 5 mM oligo (dT) primers, 10 U/mL M‐MLV reverse transcriptase, 1 mM dNTPs, 1 U/mL RNase inhibitor, 1X RT buffer. The reverse transcription reaction was performed in three steps: 10 min at 70°C, 2 min at 4°C, and 60 min at 37°C. ViiA7 Real‐Time Polymerase Chain Reaction (RT‐PCR) Detection System (Applied Biosystems, Foster City, CA, USA) was used for Real‐time PCR, for which were used 6 µL of SYBR Green Master Mix, 6 pmol of forward and reverse primers, and 2 µL of cDNA. The Real‐time PCR reaction steps were 10 min at 95°C, 40 cycles at 95°C for 15 s each, and finally at 60°C for 60 s. Primers sequences were CYT B (F: CCAGCTACCATGTCCCAGAT, R: TATGCCAGCTTCCGACTCTT) and glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) (F: GAGTCAACGGATTTGGTCGT, R: TTGATTTTGGAGGGA TCTCG). NQO1 QuantiTect primers were provided by Qiagen (Qiagen, Hilden, Germany). GAPDH was used as an endogenous reference. Quantitative RT‐PCR was performed with the ViiA7 RT‐PCR System (Applied Biosystems, Foster City, CA, USA) using the iQ SYBR Green Supermix method (Bio‐Rad Laboratories, Richmond, CA, USA) according to the manufacturer's instructions. The comparative Ct method was used for relative quantification. Data were presented as the fold change in target gene expression. GAPDH was used as a calibrator. The comparative Ct method was used for relative quantification. Data were presented as the fold change in target gene expression.
Statistical Analysis
4.7
The results are presented as mean ± standard error mean of three independent replicates. Data were analyzed using a one‐way analysis of variance test, followed by Dunnett's test for multiple comparisons. A p‐value < 0.05 was considered significant. Statistical analyses were performed using GraphPad Prism 9.0.0 (GraphPad Prism Software, San Diego, CA, USA).
Author Contributions
Andrea Mastinu, Giulia Abate, Luisa Pistelli, and Guido Flamini were responsible for conceptualization. Ylenia Pieracci and Gianluca Angius contributed to the data collection. Eileen Mac Sweeney, Ylenia Pieracci, Vlad Sebastian Popescu, and Gianluca Angius conducted the analysis and produced the results and figures. Eileen Mac Sweeney, Vlad Sebastian Popescu, and Gianluca Angius drafted the manuscript. All the authors have read and approved the final manuscript.
Conflicts of Interest
The authors declare no conflicts of interest.
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1M. Petruzzello , List of Plants in the Family Lamiaceae (Edinburgh: Encyclopedia Britannica, Inc., 2021), https://www.britannica.com/topic/list‐of‐plants‐in‐the‐family‐Lamiaceae‐2035853.
- 2The Editors of Encyclopædia Britannica , Lavender (Edinburgh: Encyclopedia Britannica, 2024), Accessed 8 July 8, 2024. https://www.britannica.com/plant/lavender.
- 3B. Salehi , D. Mnayer , B. Özçelik , et al., “Plants of the Genus Lavandula: From Farm to Pharmacy,” Natural Products Communications 13 (2018): 1385–1402, 10.1177/1934578 X 1801301037. · doi ↗
- 4N. Dobros , K. Zawada , and K. Paradowska , “Phytochemical Profile and Antioxidant Activity of Lavandula Angustifolia and Lavandula X Intermedia Cultivars Extracted With Different Methods,” Antioxidants 11 (2022): 711, 10.3390/antiox 11040711.35453396 PMC 9027103 · doi ↗ · pubmed ↗
- 5N. Dobros , K. D. Zawada , and K. Paradowska , “Phytochemical Profiling, Antioxidant and Anti‐Inflammatory Activity of Plants Belonging to the Lavandula Genus,” Molecules 28 (2023): 256, 10.3390/molecules 28010256.PMC 982198836615453 · doi ↗ · pubmed ↗
- 6P. H. Koulivand , M. K. Ghadiri , and A. Gorji , “Lavender and the Nervous System,” Evidence‐Based Complementary and Alternative Medicine 2013 (2013): 681304, 10.1155/2013/681304.23573142 PMC 3612440 · doi ↗ · pubmed ↗
- 7K. Pokajewicz , M. Czarniecka‐Wiera , A. Krajewska , E. Maciejczyk , and P. P. Wieczorek , “ Lavandula x Intermedia—A Bastard Lavender or a Plant of Many Values? Part I Biology and Chemical Composition of Lavandin,” Molecules 28 (2023): 2943, 10.3390/molecules 28072943.PMC 1009605837049706 · doi ↗ · pubmed ↗
- 8J. A. Birchler , “Heterosis in Plants,” Encyclopedia of Agriculture and Food Systems (2014): 539–543, 10.1016/B 978-0-444-52512-3.00227-8. · doi ↗
