Innovation in the Processing of Native Round Fish: A Readjustment of the Processing Workflow for Salmonella spp. Control in a Fish Processing Plant in the State of Mato Grosso
Jaqueline Oliveira Reis, Nathaly Barros Nunes, Yuri Duarte Porto, Adelino Cunha Neto, Sara Rodrigues de Souza, Washington da Guia Fonseca, Alexsandro da Silva Siqueira, Luciana Kimie Savay-da-Silva, Eduardo Eustáquio de Souza Figueiredo

TL;DR
This study shows that adjusting the fish processing workflow can significantly reduce Salmonella contamination, improving food safety for consumers.
Contribution
A modified processing workflow was developed and tested, achieving complete elimination of Salmonella in fish processing.
Findings
The modified processing flowchart completely eliminated Salmonella spp. contamination.
An adapted version of the modified flowchart reduced contamination from 56.7% to 3.3%.
Separating dirty and clean processing areas reduced cross-contamination effectively.
Abstract
The presence of Salmonella spp. in fish poses a risk to public health, even though this bacterium is not part of the natural microbiota of fish. The main source of contamination is the production and processing environment. In Brazil, washing with chlorinated water at 5 ppm is required, but this measure is not always effective. This study was conducted in a fish processing plant in the state of Mato Grosso to identify failures in the processing flowchart and propose improvements. Three treatments were tested: the conventional process, a modified flowchart, and a modified flowchart adapted to the plant’s structure. The modified treatment completely eliminated Salmonella spp., while the adapted version reduced contamination from 56.7% to only 3.3%. The main change was the physical separation between dirty areas (gill and scale removal) and clean areas (evisceration and filleting),…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5- —Government of Mato Grosso, Brazil (SEDEC-MT)
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsFood Safety and Hygiene · Aquaculture Nutrition and Growth
1. Introduction
The fisheries and aquaculture sectors have been gaining increasing recognition for their strategic importance in promoting global food and nutrition security. Projections indicate that, by 2032, these sectors are expected to experience significant growth in production, consumption, and trade. Total aquatic animal production is expected to reach 205 million tons by 2032, with the primary increase coming from aquaculture, contributing 101 million tons in 2030 [1]. According to the Brazilian Fish Farming Association Peixe BR [2], the production chain of farmed fish in Brazil ranks seventh in the world for freshwater fish production. Regarding native fish production, Brazil produced 258,705 tons in 2024. Among the five Brazilian states considered the largest producers of native round fish from the Amazon, Mato Grosso was the only one to show an increase in production, moving from third place in 2022 to second place in 2023, reaching a production of 44,520 thousand tons in 2024.
Despite its high production, consumption, and nutritional importance, fish is considered an animal-based food particularly vulnerable to microbiological contamination [3], posing a significant risk to food safety. Among the main pathogens associated with this type of product, Salmonella spp. stands out, with its presence linked both to the natural habitat conditions of fish and to inadequate handling and processing practices. Salmonella contamination in fish represents a public health threat, requiring effective control measures throughout the production chain [4].
Pathogenic microorganisms such as Salmonella spp. can be introduced into fish and their final products during both the farming and processing stages [5]. While Salmonella spp. is not part of the fish microbiota, it can be introduced through the farming environment, such as through contaminated water, sediments, and other factors [6]. Fish contamination in processing plants can occur at all stages of processing, including transportation, washing with hyperchlorinated water, evisceration, scaling, and filleting, as well as through contact with contaminated water, cutting boards, knives, trays, and plastic boxes. Parts such as scales, gills, and viscera can potentially be contaminated and can transfer microorganisms to the fish during processing, increasing the risk of contamination [7]. Additionally, there are other factors that may promote the persistence of this microorganism in fish, which are currently being investigated by our research group, such as the interaction of organic matter with chlorine effectiveness and the exposure time of Salmonella to chlorine [8,9]. Therefore, protective measures against foodborne pathogens should be implemented, as well as ensuring proper sanitary conditions from processing to commercialization of the fish.
To ensure the quality of final products, the Ministry of Agriculture and Livestock (MAPA) mandates the use of a surface wash with 5 ppm of free residual chlorine. This wash is the only measure that has been proposed to prevent the persistence of pathogenic microorganisms on fish surfaces [10]. Despite the mandatory use of chlorine in fish washing, Salmonella serotypes have been detected in water, fish (such as tambaqui and pintado), and production farms in the state of Mato Grosso [11], as well as in processing plants (Fernandes et al., 2018) [7]. What is most concerning is that the bacteria have also been found in a study conducted by our research group in products ready for commercialization in the state of Mato Grosso, such as eviscerated and frozen fish, frozen tambaqui belly, and frozen pintado fillets [12]. These fish certainly underwent the required hyperchlorinated water washing process, yet the bacteria remained present. This highlights the serious public health risk, as these products, intended for direct consumption, could lead to severe infections in consumers, underscoring the need for more effective control measures.
Given the risks associated with Salmonella spp. contamination in fish and the need to improve sanitary procedures during processing [13], this study aimed to test an alternative surface washing protocol and adapt an industrial-scale slaughter flowchart for the control of Salmonella spp. in native round fish.
2. Materials and Methods
2.1. Experimental Design
An experiment was conducted at a native round fish processing plant in Cuiabá, in the state of Mato Grosso. This medium-sized facility processes approximately 7 tons of fish per day. The fish species selected was a hybrid (Colossoma macropomum × Piaractus brachypomus), sourced directly from an excavated tank within the property, with an average weight of 976.1 ± 313.4 g (mean ± standard deviation; n = 90). The fish were harvested with fishing nets and slaughtered through thermal shock stunning for one hour. There was no need for artificial contamination, as the property was already experiencing contamination in the excavated tanks. Additionally, prior Salmonella analyses had confirmed the presence of the bacteria in both the tank and the fish.
2.2. Treatments
The treatments were divided into three flowcharts: the first simulated the fish processing performed by the establishment, while the other two represented modified flowcharts. Before being applied on an industrial scale, these flowcharts were tested on a laboratory scale. A total of 90 final product samples (whole carcasses) were analyzed, distributed among the three treatments.
2.2.1. Treatment 1
Thirty samples were collected after undergoing the routine processing workflow of the facility, which is similar to the processing applied by the fish processing plant, as shown in Figure 1, below.
2.2.2. Treatment 2
Thirty fish were collected after undergoing the improved processing workflow. The main changes implemented included the removal of the gills in an external area considered a dirty area, which occurred in the first stage. In the second stage, also in the external area, the scales were removed using a pressure pump. After this stage, the fish were washed with hyperchlorinated water at 5 ppm, still in the external environment, using the pump at minimum pressure, as shown in Figure 2. After this wash, the fish entered the processing plant for evisceration, which was performed by two workers: one to open the fish’s abdominal cavity and another to remove the viscera, ensuring that the intestinal contents did not come into contact with the carcass. Following this, the fish underwent another wash with potable water, both internally and externally, and were ready to proceed to the filleting stage. If the viscera ruptured, the fish were discarded, the workbench was washed with hyperchlorinated water at 25 ppm (a concentration used exclusively for surfaces in contact with fish), following the recommendation of the FAO (2008) [14], the knives and cutting boards were replaced, and the handlers sanitized their hands and changed gloves.
2.2.3. Treatment 3
An approach combining the modified treatment with the specific conditions of the facility was used, as shown in Figure 3. In this treatment, the removal of the gills was carried out in an external area, outside the processing zone. The fish were then washed with potable water using a low-pressure water pump. Only after this step were the fish subjected to washing with hyperchlorinated water at 5 ppm, using the facility’s equipment (a washing conveyor with a spraying system), and then the fish were directed to the processing area inside the plant. In the processing plant, the next step was the removal of the scales, performed with the facility’s scaling equipment. After scaling, the fish proceeded to the evisceration stage, carried out by two workers: one responsible for opening the abdominal cavity and the other for removing the viscera, ensuring that they did not rupture during the process. In cases of viscera rupture, the fish were discarded, and the workbench, materials, and utensils were sanitized with hyperchlorinated water at 25 ppm, following the recommendation of the FAO (2008) [14] for surfaces in direct contact with fish. Knives and cutting boards were replaced, and handlers sanitized their hands and changed gloves to maintain the hygiene of the environment.
2.3. Sample Collection
The washing of the eviscerated and chilled carcass (final product) was carried out according to the ISO 17604:2015 protocol [15]. According to the protocol, a sterile peptone saline solution was prepared, with a volume in the proportion of 1:4 relative to the weight of the fish (for example, for a 1000 g carcass, 250 mL of the solution was used). The fish was transferred to a sterile container, and 250 mL of peptone saline solution was added. The container was shaken manually, rotating the liquid inside to wash the entire internal and external surface of the fish for approximately 3 min. The resulting liquid was used for presence/absence tests to be applied in the subsequent stages of analysis.
2.4. Research on Salmonella spp.
The method used for the recovery and isolation of Salmonella spp. was essentially divided into four steps. In the first pre-enrichment step, 25 mL of the wash sample was inoculated into 225 mL of the non-selective liquid medium, buffered peptone water (BPW). These samples were incubated at a temperature of 37 ± 1 °C for 18 ± 24 h [16].
2.5. Enrichment in Selective Liquid Culture Medium
From the pre-enrichment broth, 0.1 mL aliquots were inoculated into Rappaport–Vassiliadis soya broth (RVS broth), and 1.0 mL aliquots were inoculated into Muller–Kauffmann tetrathionate broth with novobiocin (MKTT broth). After inoculation, the RVS broth was incubated at 41.5 ± 1 °C for 24 ± 3 h, and the MKTT broth at 37 ± 1 °C for 24 ± 3 h [16].
2.6. Plating, Identification, and Biochemical Tests
The culture obtained from selective enrichment was streaked onto two selective media: Xylose Lysine Deoxycholate Agar (XLD Agar, Kasvi, Conda S.A, Madrid, Spain) and Brilliant Green Agar (BGA, Kasvi, Conda S.A, Madrid, Spain). The XLD Agar was incubated at 37 ± 1 °C and examined after 24 ± 3 h. The BGA was incubated at 42 °C for 24 h. After this period, three characteristic colonies of BGA and XLD of each sample were streaked onto nutrient agar tubes to obtain abundant growth of the strain for further identification with biochemical tests. The biochemical tests TSI (Triple Sugar Iron Agar, Kasvi, Conda S.A, Madrid, Spain) and LIA (Lysine Iron Agar, Kasvi, Conda S.A, Madrid, Spain) were performed by inoculating pure colonies taken from nutrient agar tubes into the respective media, followed by incubation at 37 °C for 18 to 24 h. The TSI test evaluated the fermentation of sugars (glucose, lactose, and/or sucrose), gas production, and hydrogen sulphide (H_2_S) formation, based on colour changes and the presence of black precipitate. The LIA test assessed lysine decarboxylation or deamination and H_2_S production, with results interpreted according to medium colour changes and the presence of precipitate [16].
2.7. DNA Extraction and Analysis for the Confirmation of Salmonella spp.
Colonies testing positive for Salmonella spp. through biochemical test readings underwent an additional confirmation step using Polymerase Chain Reaction (PCR). For this purpose, DNA extraction was performed using thermal lysis. Isolated bacterial colonies were reactivated in BHI (Brain Heart Infusion, Conda S.A, Madrid, Spain) broth, and then 1 mL of the suspension was centrifuged at 10,000 rpm for 5 min. The supernatant was discarded, and this process was repeated until the complete formation of the bacterial pellet. The resulting pellets were resuspended in 300 µL of sterile ultrapure water and incubated in a heat block at 100 °C for 10 min. Subsequently, the tubes were chilled on ice for 10 min and centrifuged again at 10,000 rpm for 5 min. The supernatant containing the DNA was transferred to sterile tubes and used in PCRs. The primers used contained the hilA gene, with the following sequences; forward: CTGCCGCAGTGTTAAGGATA and reverse: CTGTCGCCTTAATCGCATGT. The equipment used was a thermocycler from Applied Biosystems by Life Technologies, model 9902 (Singapore). The cycling conditions followed the protocol described by Guo et al. (2000) [17]: 94 °C for 5 min, followed by 35 cycles of 94 °C for 1 min, annealing at 58 °C for 1 min, extension at 72 °C for 1 min, and a final extension at 72 °C for 10 min.
2.8. Agarose Gel Electrophoresis
A 1.5% agarose gel was prepared using TEB buffer. To allow the visualization of DNA fragments, 1 µL of ethidium bromide was added directly to the gel. In the wells designated for the marker, 2 µL of Gel Blue Juice 10X and 5 µL of 100 bp DNA Ladder were loaded. For the negative control and the samples, 2 µL of Gel Blue Juice 10× and 5 µL of the amplicon were used. All reagents came from Invitrogen and Thermo Fisher Scientific (Invitrogen, Waltham, MA, USA). Electrophoresis was performed in a chamber from Loccus Biotecnologia at 100 V, 150 mA, and 20 W for 70 min. DNA fragment visualization was carried out using a transilluminator from DNR Bio Imaging Systems (Jerusalem, Israel), model MiniBIS Pro.
2.9. Data Analysis
Fisher’s Exact Test was applied to assess the association between fish washing treatments (Treatment 1, Treatment 2, and Treatment 3) and the occurrence of Salmonella spp. contamination (presence/absence), considering a significance level of 5% and 95% confidence intervals (CI). This test is suitable for small sample sizes and was applied because of the low frequencies observed in the results. Additionally, the odds ratio (OR) was calculated to quantify the strength of association, representing the likelihood of increased or decreased contamination in one treatment compared to another. All analyses were conducted using R^®^ software version 4.2.3 (R Core Team, Vienna, Austria, 2023), with the “stats” package for Fisher’s Exact Test and the “epiR” package (Stevenson & Sergeant, 2024) [18] for OR and CI calculations.
3. Results
The PCR results were confirmed through the analysis of the profiles obtained in agarose gel electrophoresis, where the positive samples showed bands approximately 497 base pairs (bp) in size, consistent with the expected size for the target gene hilA of Salmonella spp. These results can be visualized in Figure 4, corresponding to the image of the agarose gel at a 1.5% concentration.
According to the confirmation obtained through the analysis of all samples subjected to gel electrophoresis, the results showed marked differences in the contamination rates by Salmonella spp. among the flowcharts evaluated. In treatment 1 (conventional flowchart), 56.7% of the fish samples analyzed showed contamination by Salmonella spp. after processing. In treatment 2 (readjusted flowchart), no samples showed contamination, indicating the absence of Salmonella spp. at the end of this flowchart. In treatment 3, which integrated the flowchart readjusted to the specific conditions of the meatpacking plant, a low contamination rate was indicated, with only 3.3% of the samples detected with Salmonella spp., as observed in Scheme 1, below.
For statistical analyses, Fisher’s exact test was performed due to the low frequency of contamination observed in the treatments, ensuring the robustness of the analyses. It was observed that the readjusted flowchart (treatment 2) significantly reduced the presence of Salmonella spp. compared to the conventional flowchart (treatment 1) used in fish processing plants. No samples were detected with contamination in treatment 2, reinforcing the effectiveness of the improvements made to this flowchart that resulted in the complete absence of Salmonella spp. contamination in the fish samples analyzed (OR = ∞, CI = [7.655, ∞], p < 0.001).
The significant association with the reduction in Salmonella spp. contamination in fish samples was also observed in the flowsheet readjusted to the specific plant conditions (treatment 3) compared to the conventional flowsheet (treatment 1) (p < 0.001). The confidence interval (CI = [4.67, 1622.16]) indicates a strong reduction in the probability of contamination in treatment 3 compared to treatment 1, with an estimated odds ratio (OR) of 35.62, as seen in Table 1, below.
Despite this amplitude caused by a single sample detected with Salmonella spp., the result reinforces the effectiveness of implementing the readjusted flowchart in the processing plant to reduce contamination. This finding highlights the potential of treatment 3 for practical application in meatpacking plants, but also highlights the need for additional validation in different industrial fish processing conditions. When comparing the readjusted flowchart (treatment 2) and the flowchart readjusted to the specific conditions of the plant (treatment 3), there are indications that the risk of contamination is practically the same, suggesting that treatment 3 maintained levels of reduction in the presence of Salmonella spp. similar to treatment 2 (p = 1.0), with minimal contamination detected. These findings suggest that the readjusted flowchart (treatment 2) not only works consistently in reducing contamination by Salmonella spp. during fish processing in the meatpacking plant, but also presents high efficacy when adapted to the operational conditions of the industrial plant (treatment 3).
4. Discussion
Fish and seafood products have been associated with foodborne outbreaks, constituting about 6 to 8% of the total confirmed foodborne disease outbreaks in recent years [19]. This incidence is considered higher when compared to the incidence of foodborne outbreaks associated with poultry and beef, which contributed an average of 3.6% and 1.9% of the total outbreaks from 2011 to 2017 [19]. Based on the main pathogens associated with fish products, Salmonella has been the leading bacterial etiology for outbreaks linked to fish, highlighting significant challenges for food safety and the need for better control strategies in the seafood supply chain [20].
Salmonella spp. has been a frequently detected pathogen in fish products in several countries. In Brazil, according to a study by Fernandes et al. [7], Salmonella was detected in all areas of the fish processing environment. In the study by Cunha Neto et al. [12], Salmonella spp. was found in frozen fish belly flaps exposed for commercialization. In addition to Brazil, other countries also report this contamination, such as the study by Pal et al. [21], which analyzed frozen catfish fillets purchased from retail stores in Vietnam and found Salmonella in 42% of the samples. Another study conducted in the United States in fish processing plants examined the microbiological quality of frozen catfish fillets and detected Salmonella in 5.3% of the samples [22].
There are several factors that contribute to the persistence of Salmonella spp. on the surface of fish after processing. The receiving stage is one of the critical points in industrial processing [7], since fish often arrive at the plant already contaminated externally, such as in their scales, in addition to being loaded with organic matter, including mud, soil, and mucus [23]. The effectiveness of sodium hypochlorite (NaClO) during washing with 5 ppm chlorinated water is significantly reduced due to the high load of organic matter present on the fish. This organic matter reacts with the available NaClO, decreasing its effective concentration. This effect was reported by Narayan et al. [24], who observed a reduction of approximately ten times in the concentration of free chlorine in the presence of 5% organic matter. Reis et al. [8] also demonstrated that the addition of 1% to 5% organic matter in a solution containing 5 ppm chlorine reduced the availability of free chlorine to only 1.43 ppm. This reinforces the need to perform a preliminary wash to remove dirt (organic matter) at the receiving stage, before washing with 5 ppm chlorinated water, which can significantly reduce the risk of cross-contamination associated with the entry of fish into the clean processing area still with scales, potentially carrying pathogens such as Salmonella. Our research identified that the chlorinated water baths used in this industry have an extremely short duration of available active chlorine, typically only a few seconds, which may be insufficient to inactivate Salmonella spp. The exposure time and the concentration of sodium hypochlorite are important factors for the effective inactivation of and/or reduction in Salmonella spp. [9]. According to Reis et al. [8], a significant reduction in Salmonella spp., greater than 5 logs in the presence of organic matter, requires the sodium hypochlorite to remain in contact with the pathogen for approximately 30 min.
Gills and scales are recognized as potential sources of contamination in fish [7,25], and when handled in the clean area, they can cause cross-contamination, compromising the microbiological quality of the final product [5]. Therefore, it can be suggested that the removal of gills and scales carried out outside the clean area, as in procedures implemented in the enhanced processing of fish (treatments 2 and 3, as seen in Figure 1 and Figure 2), was responsible for the success in eliminating and/or reducing the presence of Salmonella spp. in the final product.
Despite the common practice of washing fish with 5 ppm chlorinated water in processing facilities (treatment 1), many fish still enter the clean area with scales, which can serve as carriers of microorganisms and contribute to cross-contamination [7,25,26]. Studies have shown that inadequate handling practices and equipment sanitation, particularly in the evisceration area, are critical factors influencing the microbiological safety of the final product [5]. In one case, up to 50% of raw processing samples and over 15% of finished products were contaminated with Salmonella spp., highlighting persistent failures in sanitary control procedures [27].
The results of the analyses implemented on samples subjected to conventional processing (treatment 1, Figure 1) show that there is contamination by Salmonella spp. in 56.7% of the samples analyzed in this group. These results were found even after the use of 5 ppm chlorinated water. However, factors such as the very quick removal of the viscera and the fact that most fish had ruptured viscera during this stage were observed, which may have favoured cross-contamination, as this organ can harbour a higher concentration of the pathogen [28]. These actions compromised more than half of the samples with Salmonella spp. Additionally, another study [29] investigated the occurrence of Salmonella spp. in tilapia processing plants intended for the production of ready-to-eat sashimi, demonstrating the presence of the pathogen in different areas of the production line, including the descaling and evisceration steps. Exactly the same critical points were identified in the present study as the main factors contributing to cross-contamination and, consequently, to the contamination of the final product. The isolation rates of Salmonella spp. in these steps ranged from 10.2% to 36.1%. Moreover, the pathogen was also identified on processing surfaces, with an isolation rate of 10.5%, reinforcing the importance of strict sanitary control throughout the production chain. Finally, Salmonella spp. was also detected in the final products, with isolation rates ranging from 4.6% to 36.1%, highlighting the risk of contamination persisting throughout processing and reaching the end consumer. These findings reinforce the need for adjustments in processing protocols to mitigate microbiological contamination risks. In Brazil, this concern is even more relevant considering the current legislation, Normative Instruction No. 161, dated 1 July 2022, which establishes the mandatory absence of Salmonella in fish and their derivatives, including seafood [30].
An intervention was implemented (treatment 2, Figure 2), where the viscera were carefully removed to prevent rupturing, ensuring that intestinal contents did not come into contact with the fish carcasses. However, if the viscera were ruptured, the handlers were trained to discard the fish outside the processing area, and immediately clean all surfaces in contact with the fish (countertops, cutting boards) in the evisceration area with 25 ppm chlorinated water [14]. Knives and sharpening steels were replaced, and handlers’ gloves were changed. This ensured the success of treatment 2 (enhanced, Scheme 1) to prevent cross-contamination during processing, which resulted in 100% of the samples being free from Salmonella spp. contamination.
The success achieved with treatment 2 (enhanced) was also observed in treatment 3, which used the enhanced flowchart procedure, executed with the equipment available in the industry. A low contamination rate of only 3.3% of the samples was observed, compared to the 56.7% observed in treatment 1, as seen in Table 1 These results indicate that, even with a contamination rate of 3.3%, which is considered very low, there was no statistically significant difference. Therefore, the main factor to be considered for the success of the process was the modification of the flowchart, with the separation of processing stages into dirty areas (gill and scale removal) and clean areas (evisceration and filleting). Thus, the implementation of the enhanced flowchart can be a viable and efficient strategy to improve contamination control in the fish slaughter industry, without the need for large investments in new equipment. This feasibility is also evidenced by the analysis of operational costs, as there is no significant increase in total costs with the adoption of treatments 2 and 3 (Figure 2 and Figure 3) compared to the conventional treatment (Figure 1). The main difference between the methods lies in the use of a high-pressure water pump (treatment 2, Figure 2), a low-cost piece of equipment that is generally already available in most slaughterhouses, and in the need for greater attention during the evisceration step (treatments 2 and 3, Figure 2 and Figure 3), especially to avoid rupturing the viscera. This extra care makes the process slower, which justifies the need for more workers to maintain production line efficiency. At the slaughterhouse in which the study was conducted, evisceration is normally carried out by two workers; due to the slower process caused by this additional care, four workers were assigned to perform this task in treatments 2 and 3. However, over time, workers tend to develop greater skill in carrying out this task, which can help optimize the process.
Moreover, as workers develop greater skill over time, the process becomes not only more efficient but also more consistent, which contributes to improved food safety outcomes. This, in turn, can significantly reduce contamination rates [27], reinforcing the potential of the process to meet more stringent microbiological control standards. This improves the ability of the domestic industry to meet the requirements of international markets, expanding export opportunities and strengthening its position in the global market.
5. Conclusions
The results of this study demonstrate that the proper separation of processing areas between dirty zones (gill and scale removal) and clean zones (evisceration and filleting), combined with the training of the evisceration team, is essential for controlling Salmonella spp. contamination in native round fish. The modified processing flowchart proved effective even without equipment replacement, as long as the processing steps were properly separated. Additionally, the use of 5 ppm of free residual chlorine was effective under these conditions. It is recommended that fish processing plants reorganize their processing line layout to physically separate dirty and clean steps, implementing structural barriers and promoting continuous staff training as key control strategies.
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1FAO The State of World Fisheries and Aquaculture 2024—Blue Transformation in Action FAO Rome, Italy 202410.4060/cd 0683 en · doi ↗
- 2Brasil, 2025 Anuário da Piscicultura 2025 Associação Brasileira da Piscicultura São Paulo, Brazil 2025 Available online: https://www.peixebr.com.br/anuario-2025/(accessed on 18 March 2025)
- 3Leitão M.F.F. Rios D.P.F.A. Guimarães J.G.L. Baldini V.L.S. Mainades Pinto C.S.R. Alterações químicas e microbiológicas em pacu (Piaractus mesopotamicus) armazenado sob refrigeração a 5 °C Ciênc Tecnol. Aliment.19971716016610.1590/S 0101-20611997000200018 · doi ↗
- 4Nunes M.L. Batista I. Aplicação do Índice de Qualidade (QIM) na Avaliação da Frescura do Pescado IPIMAR Divulgação Lisboa, Portugal 2004 Volume 29Available online: https://comum.rcaap.pt/bitstream/10400.26/33873/1/Aplica%C 3%A 7%C 3%A 3o%20do%20%C 3%A Dndice%20de%20qualidade%20%28QIM%29%20na%20avalia%C 3%A 7%C 3%A 3o%20da%20frescura%20do%20pescado.pdf(accessed on 18 February 2025)
- 5Sheng L. Wang L. The microbial safety of fish and fish products: Recent advances in understanding its significance, contamination sources, and control strategies Compr. Rev. Food Sci. Food Saf.20212073878610.1111/1541-4337.1267133325100 · doi ↗ · pubmed ↗
- 6Porto Y.D. Fogaça F.H.D.S. Andrade A.O. da Silva L.K.S. Lima J.P. da Silva J.L. Vieira B.S. Cunha Neto A. Figueiredo E.E.D.S. Tassinari W.D.S. Salmonella spp. in Aquaculture: An Exploratory Analysis (Integrative Review) of Microbiological Diagnoses between 2000 and 2020 Animals 2022132710.3390/ani 1301002736611639 PMC 9817981 · doi ↗ · pubmed ↗
- 7Fernandes D.V.G.S. Castro V.S. Cunha Neto A.D. Figueiredo E.E.D.S. Salmonella spp. in the Fish Production Chain: A Review Cienc. Rural 201848 e 2018014110.1590/0103-8478 cr 20180141 · doi ↗
- 8Reis J.O. Cavalcante C.B. Nunes N.B. Neto A.C. Machado M.A.M. Porto Y.D. Castro V.S. Figueiredo E.E.d.S. Influence of Organic Matter from Native Fish on the Antimicrobial Efficacy of Sodium Hypochlorite (Na Cl O) in Reducing Salmonella spp. Population Microbiol. Res.20241534235310.3390/microbiolres 15010023 · doi ↗
