Author Correction: CRISPR screens reveal convergent targeting strategies against evolutionarily distinct chemoresistance in cancer
Chunge Zhong, Wen-Jie Jiang, Yingjia Yao, Zexu Li, You Li, Shengnan Wang, Xiaofeng Wang, Wenjuan Zhu, Siqi Wu, Jing Wang, Shuangshuang Fan, Shixin Ma, Yeshu Liu, Han Zhang, Wenchang Zhao, Lu Zhao, Yi Feng, Zihan Li, Ruifang Guo, Li Yu, Fengyun Pei, Jun Hu, Xingzhi Feng
Abstract
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsScience, Research, and Medicine
Correction to: Nature Communications 10.1038/s41467-024-49673-4, published online 29 June 2024
In the version of the article initially published, in the section “A systematic view on genetic maps of chemoresistance”, the sentence “Microtubule-related genes such as KIF1C…” has been corrected to “Microtubule-related genes such as KIFC1…” in the HTML and PDF versions of the article. In Supplementary Data 6, two oligo sequences were incorrectly written as ‘sgRNA_MMACHC-2_Forward: CACCGGGTGTATGCACACACCTGA’ and ‘sgRNA_MMACHC-2_Reverse: AAACTCAGGTGTGTGCATACACCC’. The correct version should be ‘sgRNA_MMACHC-2_Forward: CACCGCTAACACGGCCCAGATGGT’ and ‘sgRNA_MMACHC-2_Reverse: AAACACCATCTGGGCCGTGTTAGC’. A corrected version of Supplementary Data 6 is now available online.
Supplementary information
Updated Dataset 6