Correction: Yokoi et al. Erythritol Can Inhibit the Expression of Senescence Molecules in Mouse Gingival Tissues and Human Gingival Fibroblasts. Nutrients 2023, 15, 4050
Haruna Yokoi, Masae Furukawa, Jingshu Wang, Yu Aoki, Resmi Raju, Yoriko Ikuyo, Mitsuyoshi Yamada, Yosuke Shikama, Kenji Matsushita
Abstract
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsTelomeres, Telomerase, and Senescence · Neutrophil, Myeloperoxidase and Oxidative Mechanisms · Cytomegalovirus and herpesvirus research
Text Correction
Upon review, we have identified an error in the human TNF-α primer sequence reported in Table 1 of our paper titled “Erythritol can inhibit the expression of senescence molecules in mouse gingival tissues and human gingival fibroblasts” [1]. The incorrect sequence was inadvertently included due to an oversight during manuscript preparation. The sequence did not yield successful amplification in our experiments and was not used in the data presented. We provide here the correct primer sequences that were utilized:
TNF-α (F)—CCCAGGGACCTCTCTCTAATC
TNF-α (R)—ATGGCTACAGGCTTGTCACT
The authors state that the scientific conclusions are unaffected. This correction was approved by the Academic Editor. The original publication has also been updated.
The authors thank the readers and the journal for their understanding.
The reference list from the paper itself. Each links out to its DOI / PubMed record.