Author Correction: A cost-effective RNA extraction and RT-qPCR approach to detect California serogroup viruses from pooled mosquito samples
Marc Avramov, Vanessa Gallo, Antonia Gross, David R. Lapen, Antoinette Ludwig, Catherine I. Cullingham
Abstract
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsMosquito-borne diseases and control · Vector-Borne Animal Diseases · Viral Infections and Vectors
Correction to: Scientific Reports 10.1038/s41598-024-52534-1, published online 29 January 2024
The original version of this Article contained an error. In the Methods section, under the subheading ‘Real-time reverse transcription PCR (RT-qPCR)’, where an internal control probe for RT-qPCR was incorrect.
"The probe for CSGv was labeled with the reporter dye 6-carboxyfluorescein (6-FAM) at the 5′ end and a minor groove binder (MGB) at the 3′ end, following the design by Wang et al.^11^. The internal control’s probe (sequence: 5′ – CAGGTGCAAATGGA – 3′) was custom-designed using the PrimerQuest™ Tool (IDTech™, USA) labeled with the reporter dye 5-carboxytetramethylrhodamine (5-TAMRA) at the 5′ end and the quencher Iowa Black® RQ (IBRQ) (IDTech™, USA) at the 3′ end."
now reads:
"The probe for CSGv was labeled with the reporter dye 6-carboxyfluorescein (6-FAM) at the 5′ end and a minor groove binder (MGB) at the 3′ end, following the design by Wang et al.^11^. The internal control’s probe (sequence: 5′ - ATCAAGTGGAGGGCAAGTCTGGTG - 3′) was custom-designed using the PrimerQuest™ Tool (IDTech™, USA) labeled with the reporter dye 5-carboxytetramethylrhodamine (5-TAMRA) at the 5′ end and the quencher Iowa Black® RQ (IBRQ) (IDTech™, USA) at the 3′ end."
The original Article has been corrected.