Draft genome sequences of two Gluconobacter strains isolated from spoiled orange juice

TL;DR

This paper reports the draft genomes of two Gluconobacter strains from spoiled orange juice to better understand these bacteria for industrial use.

Contribution

The novelty lies in providing new draft genome sequences of Gluconobacter strains from a food spoilage context.

Findings

Two Gluconobacter strains were isolated from spoiled orange juice.

Draft genome sequences of these strains were generated.

The study contributes to understanding acetic acid bacteria diversity.

Abstract

Here, we present the draft genome sequences of two Gluconobacter strains that were isolated from spoiled orange juice. Gluconobacter are members of the acetic acid bacteria and are known for their unique metabolism and use in industry. Understanding acetic acid bacteria diversity is essential for engineering further optimized industrial strains.

Tables

TABLE 1. Genome assembly statistics, annotation features, and data accession numbers

Strain	Gluconobacter sp. OJA	Gluconobacter sp. OJB
Illumina data
No. of raw reads generated	5,519,762	6,368,484
No. of raw Mb generated	811.69	936.36
No. of reads after filtering	5,295,054	6,109,328
No. of Mb after filtering	733.67	892.74
Fold coverage	211.83	280.65
SRA ID	SRX24435052	SRX24435054
Nanopore data
No. of raw reads generated	105,690	539,216
No. of raw Mb generated	490.66	2137.17
N 50	11,732	7,350
No. of reads after filtering	105,690	539,216
No. of Mb after filtering	401.46	1835.80
Fold coverage	121.80	624.20
SRA ID	SRX24435053	SRX24435055
Hybrid assembly
Total length	3,794,501	3,305,620
N 50	2,287,605	2,819,765
L 50	1	1
No. of contigs	11	10
GC content (%)	56.19	58.21
Completeness (%) a	97.93	96.01
Contamination (%) a	7.44	7.58
Genome annotation
Protein-coding genes	3,419	3,054
5S rRNA	4	4
16S rRNA	4	4
23S rRNA	4	4
tRNAs	57	58
Taxonomic classification
Placement reference	GCA_002723935.1	GCA_018811965.1
Placement taxonomy b	Gluconobacter cerinus	Gluconobacter cerevisiae
Placement ANI	96.95	96.45
Accession numbers
BioProject accession	PRJNA1107211	PRJNA1107211
Biosample accession	SAMN41163485	SAMN41163486
GenBank accession	JBDIWI000000000	JBDIWH000000000

Full text

ANNOUNCEMENT

Acetic acid bacteria (AAB) incompletely oxidize growth substrates using membrane-bound dehydrogenases (1, 2). The byproducts diffuse into the media, which makes them industrially useful for production of vinegar, vitamin C, the antidiabetic drug miglitol, dihydroxyacetone, and many artificial flavorings (3 – 5). To expand upon known AAB diversity and identify new targets for strain design, we sequenced the genomes of two Gluconobacter strains.

These Gluconobacter strains were isolated from spoiled Fit & Active Orange Juice Beverage purchased in Onalaska, WI. Samples were plated onto YG medium (6 g/L yeast extract, 20 g/L glucose, 2.5 g/L MgSO_4_ × 7H_2_O, 1 g/L (NH_4_)2_SO_4, 1 g/L KH_2_PO_4_, pH 6.0) with 50 µg/mL cefoxitin and incubated at 30°C for 3 days. For initial isolation, 20 g/L CaCO_3_ was added to differentiate AAB colonies, and 15 g/L agar was added to make solid media. Isolated colonies producing zones of clearance were selected and passaged to purity. Genomic DNA was isolated from single colonies grown in YG broth using the DNeasy UltraClean Microbial Kit (QIAGEN, Ann Arbor, MI). The 16S rRNA gene was amplified using primers 8FE/1492R and Sanger sequenced by Eurofins Genomics (Louisville, KY) using their 16F primer (CGGTTACCTTGTTACGACTT). Two isolates were identified as Gluconobacter spp. using the NCBI BLAST RefSeq database. The isolates Gluconobacter sp. OJA and OJB best matched G. cerinus (99.90% identity, E-value: 0.0, accession: NR_118192) and G. cerevisiae (99.88% identity, E-value: 0.0, accession: NR_117735).

For whole-genome sequencing, Gluconobacter sp. OJA and OJB were grown on YG agar from 15% glycerol stocks stored at −80°C. Single colonies were inoculated into YG broth with 50 µg/mL cefoxitin at 30°C with 250 rpm shaking overnight. Genomic DNA was isolated as described above. DNA was quantified using the QuantiFlor dsDNA System (Promega, Madison, Wisconsin) and sent to SeqCenter (Pittsburgh, PA) for sequencing. Illumina libraries were prepared using an Illumina DNA Prep Kit and IDT 10 bp UDI indices and sequenced on a NextSeq 2000 producing 2 × 151 bp reads. Demultiplexing and adapter removal used bcl2fastq v.2.20.0.422. Nanopore sample preparation used the Oxford Nanopore Genomic DNA by Ligation kit (SQK-LSK109) and protocol without shearing. Samples were run on a MinION using Nanopore R9 flow cells (R9.4.1). Quality control and basecalling used Guppy v5.0.16 in high-accuracy base mode (6).

Reads were processed and assembled using KBase and the Bacterial and Viral Bioinformatics Resource Center (7, 8). All software used default parameters except where noted. Read libraries were quality checked using FastQC v0.12.1 and Compute Simple Read Library Stats v2.0.2. Low-quality reads and adapter sequences were trimmed using the JGI RQCFilter pipeline (BBTools v38.22) v0.5.0, Trim Galore v0.6.5dev, and CutAdapt v4.2 (9). Trimmed reads were assembled using HybridSPAdes v3.15.3 (minimum contig length: 2,000 bp, K-mer sizes: 21, 33, 55, 77, 99, and 127). The assembled genome was annotated using the NCBI Prokaryotic Genome Annotation Pipeline (PGAP) v6.7 and deposited to NCBI (10). Summary statistics and relevant reporting information are given in Table 1.