Correction: Rapid detection of avian influenza virus based on CRISPR-Cas12a
Xu Zhou, Siwen Wang, Yue Ma, Yanbing Li, Guohua Deng, Jianzhong Shi, Xiurong Wang
Abstract
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsCRISPR and Genetic Engineering · Mosquito-borne diseases and control · interferon and immune responses
Correction: Virol J 20, 261 (2023)
https://doi.org/10.1186/s12985-023-02232-7
Following publication of the original article [1], the authors identified some errors in Fig. 5 (a b e) and Table 1 (line 18). The correct Fig. 5 and Table 1 is given below:Fig. 5. Sensitivity analysis. a, c, e Ten-fold serial dilutions of plasmid template targeting the M gene at 2.4 × 10^11^ copies/µl for the sensitivity assay; b, d, f Ten-fold serial dilutions of plasmid template targeting the NP gene at 8.67 × 10^11^ copies/µl for the sensitivity assay; (M:11–5, 2.4 × 10^11^ copies/µl-2.4 × 10^5^ copies/µl; NP:11–5, 8.67 × 10^11^ copies/µl-8.67 × 10^5^ copies/µl); g, h, i, m Ten-fold serial dilutions of RNA template targeting M gene at 6.7 × 10^11^ copies/μL for the sensitivity assay by RT-RPA/CRISPR; i, k, l, n Ten-fold serial dilutions of RNA template targeting NP gene at 12 × 10^11^ copies/μL for the sensitivity assay by RT-RPA/CRISPR. (M:11–0, 6.7 × 10^11^ copies/µl-6.7 × 10^0^ copies/µl; NP:11–0, 12 × 10^11^ copies/µl-12 × 10^0^ copies/µl). Fluorescent signals were collected every 5 min and displayed for 2 h and 30 min, respectivelyTable 1Oligonucleotides used for crRNA and RT-RPA productionPrimer nameSequence(5'to3')Product sizecrRNA-M-1UAAUUUCUACUAAGUGUAGAUAAGAAAAGACGAUCAAGAAUCCcrRNA-M-2UAAUUUCUACUAAGUGUAGAUCAGGCCUACCAGAAACGGAUcrRNA-M-3UAAUUUCUACUAAGUGUAGAUCACUCCCATCCGUUUCUGGcrRNA-M-4UAAUUUCUACUAAGUGUAGAUUGUUCACGCUCACCGUGCCCAGmRPA-4-F1CAAGACCAATCCTGTCACCTCTGACTAAGGGG103 bpmRPA-4-R1TTTTGGACAAAGCGTCTACGCTGCAGTCCTCGCTCmRPA-4-F2CAATCCTGTCACCTCTGACTAAGGGGATTTTAGGG97 bpmRPA-4-R2TTTTGGACAAAGCGTCTACGCTGCAGTCCTCGCTCmRPA-4-F3AGATCGCGCAGAGACTTGAGGATGTCTTTGCAGGG214 bpmRPA-4-R3TCCATGTTGTTTGGGTCTCCATTTCCATTTAGGGCcrRNA-NP-1UAAUUUCUACUAAGUGUAGAUCGUCUGCUUCAAAACAGCCAGNP1-RPA-F1TGGATATGACTTTGAGAGAGAAGGGTACTCCCTGG137 bpNP1-RPA-R1ATGCCATCCACACTAGTTGACTCTTGTGTGCTGGGNP1-RPA-F2TATGACTTTGAGAGAGAAGGGTACTCCCTGGTTGG212 bpNP1-RPA-R2GATAGCTGTCCTCTTGGGACCATTCTTGTCCCTCNP1-RPA-F3GAGAGAGAAGGGTACTCCCTGGTTGGAATAGATCC89 bpNP1-RPA-R3TTCTCATTTGGTCTAATGAGACTAAAGACCTGGCcrRNA-NP-2UAAUUUCUACUAAGUGUAGAUCCGGAGAAGAGACGGGAAAUGGcrRNA-NP-3UAAUUUCUACUAAGUGUAGAUUGGCAAGGUCUGCACUCAUCCUcrRNA-NP-4UAAUUUCUACUAAGUGUAGAUGAAUUUCCCUUUGAGGAUGUUGC