Whole-genome sequence and annotation of Salmonella enterica subsp. enterica strain QazSL-4

TL;DR

This paper reports the whole-genome sequence of a Salmonella strain isolated from chicken meat in Kazakhstan.

Contribution

The study provides a new genome sequence for Salmonella enterica subsp. enterica strain QazSL-4.

Findings

The genome was sequenced using Illumina MiSeq technology.

The genome consists of 49 contigs with a total length of 4,711,816 bp.

The GC content of the genome is 52.1%.

Abstract

Here, we present the whole-genome sequence of Salmonella enterica subsp. enterica strain QazSL-4 isolated from a chicken fillet in 2018, Almaty, Kazakhstan. The genome obtained using Illumina MiSeq technology consists of 49 contigs with a total length of 4,711,816 bp with a GC content of 52.1%.

Full text

ANNOUNCEMENT

We present here the whole-genome sequence of the Kazakhstan strain QazSL-4 serovar Salmonella enterica subsp. enterica. The bacterium was isolated from a sample of chicken fillets, randomly selected in Almaty’s retail market in 2018 as a part of monitoring studies of food products. Salmonella was isolated using Endo and Levin differential diagnostic media. Isolation and identification of Salmonella were carried out by standard methods described in regulatory documents (1). The bacterium Salmonella was sown in buffered peptone water, depending on the type of sample at 37°C for 24 hours, followed by selective enrichment according to Rappaport-Vassiliadis) and tetrathionate broth at 42°C and 37°C for 24 hours. Salmonella serotyping was carried out using conventional methods of agglutination and PCR (2). The following specific primers for the identification Salmonella were used in this work: SE-F: AGGTGACGCTATTGCCGGCAT; SE-R: ATGCGGGGATCTGGGCGA; and SE-probe: FAM-ATTTCGGTGGGGATGACTCGCCAT-BHQ-1.

Genomic DNA isolation was performed using the PrepMan Ultra Sample Preparation Reagent Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA). Then, 150 ng of the total genomic DNA from each isolate of QazSL-4 Salmonella enterica subsp. was used for sequencing. Library preparation and Illumina MiSeq sequencing were performed using the Nextera DNA Flex Library Prep Kit and a MiSeq Reagent Kit v3 with 300 bp paired-end reads (600 cycles) according to the manufacturer’s instructions. Quality assessment of the sequencing data (in FASTQ format) was done using FastQC v0.11.15 (3), followed by trimming of adapters and low-quality bases with a Phred quality score of less than 20 using Trimmomatic v0.39 (4). Genomes were assembled using the SPAdes assembler v3.13.2 (5) using a k-mer length of 127 with the “-careful” mode. The resulting assembly had a consensus length of 4,711,816 bp spanning 49 contigs, with an N50 value of 491,954 bp and an L50 value of three contigs. The number of reads in total—3,685,536 reads. The genome sequencing project was annotated using the NCBI Prokaryotic Genome Annotation Pipeline (6). Genome annotation predicted 4,521 coding sequences, 8 rRNA operons, 78 tRNAs, 15 ncRNAs, and 2 CRISPR arrays.

The genome project of Salmonella enterica subsp. enterica strain QazSL-4 was tested for antibiotic resistance genes using the ResFinder 4.1 comprehensive antibiotic resistance gene database (7–9), which predicted the presence of a single resistance gene homolog aac(6′)- Iaa.

The genome sequence was analyzed for prophage content using the PHAge Search Tool Enhanced Release server (10, 11). Analysis by the PHASTER program revealed 10 prophage regions, two intact regions, and eight incomplete regions.

Using SPIFinder 2.0 (12), the presence of widespread Salmonella pathogenicity islands of SPI-1, SPI-2, SPI-3, SPI-4, SPI-5, SPI-9, SPI-10, SPI-13, and SPI-14 was detected.