Draft genome sequence of a triple hybrid Escherichia coli strain isolated from a healthy donor feces

TL;DR

This paper presents the draft genome sequence of a triple hybrid Escherichia coli strain from a healthy donor's feces.

Contribution

The study provides a new draft genome sequence of a unique triple hybrid E. coli strain.

Findings

The genome assembly is 5.2 Mbp with 247 contigs.

The N50 value is 77,241 bp and GC content is 50.8%.

Abstract

Herein is reported the draft genome sequence of a triple hybrid Escherichia coli strain isolated from a healthy donor feces. The assembly is 5.2 Mbp, composed of 247 contigs, with a N50 of 77, 241 bp, presenting a GC content of 50.8%.

Tables

TABLE 1. Specific primers and PCR conditions used for molecular characterization of Ec-36.3a

Target	Sequence (5′ – 3′)	Tm (amplicon size)	Reference
ybbW	F: gtgattggcaaaatctggccg	60°C (667 bp)	(8, 9)
	R: catactggcaatcagtacgcc
bfpA	F: aatggtgcttgcgcttgctgc	67°C (326 bp)	(10)
	R: gccgctttatccaacctggta
eaeA	F: caggtcgtcgtgtctgctaaa	67°C (570 bp)	(11)
	R: tcagcgtggttggatcaacct
staI	F: ttaatagcacccggtacaagcagg	60°C (147 bp)	(12)
	R: cttgactcttcaaaagagaaaattac
daaE	F: tgactgtgaccgaagagtgc	48°C (380 bp)	(13)
	R: ttagttcgtccagtaaccccc

Full text

ANNOUNCEMENT

The relevance of Escherichia coli either as a commensal or as a pathogen has been widely documented (1). Pathogenic strains are classified as diarrheagenic (DEC) or extraintestinal (ExPEC) (2–5). Six DEC variants have been characterized and are well recognized, enteroaggregative (EAEC), enteroinvasive (EIEC), enterohaemorrhagic (EHEC), diffusely adherent (DAEC), entreotoxigenic (ETEC), and enteropathogenic Escherichia coli (EPEC) (6).

E. coli Ec-36.3 belongs to a strain collection previously characterized (7). It was isolated from a healthy donor feces in Caborca, Sonora, Mexico in October 2022. A stool sample from the healthy donor collected in a sterile container was diluted in 5 mL of saline solution, then 5 µL was plated onto a MacConkey (Becton Dickinson, BBL) agar plate and incubated aerobically at 37°C overnight. A lactose-positive colony was selected. This strain was characterized with biochemical tests using a Vitek2 system (Biomerièux, France) and molecularly using specific primers for ybbW as previously reported (Table 1) (8, 9); in addition, using a PCR approach were identified the genetic determinants of three diarrheagenic pathotypes: bfpA (but not eae, classifying it as atypical EPEC or aEPEC), staI (from ETEC), and daaE (from DAEC) (7) that codify for main subunit of bundle forming pilus, thermostable toxin, and the structural subunit of the F1845 fimbriae, respectively (Table 1). The strain was stored at −80°C in Luria Bertani (LB) broth supplemented with glycerol 20%. The sampling was carried out in accordance with the Declaration of Helsinki and a signed informed consent form was obtained from the participants.

For DNA extraction, the Ec-36.3 was plated on agar MacConkey plates and one lactose-positive colony was inoculated on 5 mL of LB broth and incubated at 37°C overnight. Genomic DNA was obtained using the Wizard Genomic DNA purification kit (Promega, USA). Illumina sequencing libraries were prepared using the tagmentation-based and PCR-based Illumina DNA Prep kit (Illumina, USA) and custom IDT 10 bp unique dual indices with a target insert size of 320 bp. Illumina sequencing was performed on an Illumina NovaSeq 6000 sequencer producing 2 × 151 bp paired-end reads. In the following analysis, default settings were used unless otherwise noted. FastQC (v0.11.9) was used for quality evaluation and Cutadapt (v4.4) for trimming and cleaning of the raw reads (14). Assembly was performed with SPAdes (v3.15.4) (15). Twenty-four contigs were removed as they were below 200 bp in length. The assembled genome was 5, 233, 542 bp in length, composed of 247 contigs, which displayed an N_50_ of 77, 241 bp and a GC content of 50.8%. The estimated sequencing depth was 80× with a coverage of 100% of the E. coli K12 reference genome according to the NCBI database pipeline.