Echinococcus granulosus ubiquitin-conjugating enzymes (E2D2 and E2N) promote the formation of liver fibrosis in TGFβ1-induced LX-2 cells
Xiaodi Du, Ruiqi Hua, Xue He, Wei Hou, Shengqiong Li, Aiguo Yang, Guangyou Yang

TL;DR
This study shows that two enzymes from a parasitic worm may contribute to liver fibrosis in infected hosts by interacting with liver cells.
Contribution
The study identifies EgE2D2 and EgE2N as secreted enzymes that promote liver fibrosis in cystic echinococcosis.
Findings
EgE2D2 and EgE2N are secreted via a non-classical pathway into the liver and hydatid fluid.
These enzymes increase fibrosis-related gene expression and enhance cell proliferation and migration in TGFβ1-induced LX-2 cells.
EgE2D2 and EgE2N are localized in key parasite structures and show distinct distribution patterns in strobilated worms.
Abstract
Cystic echinococcosis (CE) is a widespread zoonosis caused by the infection with Echinococcus granulosus sensu lato (E. granulosus s.l.). CE cysts mainly develop in the liver of intermediate hosts, characterized by the fibrotic tissue that separates host organ from parasite. However, precise mechanism underlying the formation of fibrotic tissue in CE remains unclear. To investigate the potential impact of ubiquitin-conjugating enzymes on liver fibrosis formation in CE, two members of ubiquitin-conjugating (UBC) enzyme of Echinococcus granulosus (EgE2D2 and EgE2N) were recombinantly expressed in Escherichia coli and analyzed for bioinformatics, immunogenicity, localization, and enzyme activity. In addition, the secretory pathway and their effects on the formation of liver fibrosis were also explored. Both rEgE2D2 and rEgE2N possess intact UBC domains and active sites, exhibiting…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9- —Key Technology Research and Development Program of Sichuan Province in China
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsParasitic infections in humans and animals · Congenital Anomalies and Fetal Surgery · Amoebic Infections and Treatments
Background
Cystic echinococcosis (CE) is a severe zoonotic parasitic disease caused by the metacestode of Echinococcus granulosus sensu lato (E. granulosus s.l.). It affects wild mammalians, domestic livestock, and humans, posing a significant threat to both human beings and animal husbandry. CE is distributed around most of the world, with high prevalence observed in central Asia, eastern Africa, and Mediterranean countries [1]. Neglecting the presence of CE could lead to a considerable increase in mortality rates, although the mortality rate is relatively low, ranging from 2% to 4% [2]. The World Organization for Animal Health (OIE) has classified CE as the third largest food-borne parasitic disease worldwide [3]. Furthermore, CE is included among the 17 neglected diseases identified by the World Health Organization (WHO) as targets for control in hyperendemic countries by 2030 [4].
Parasitism of E. granulosus s.l. is primarily characterized by the growth of cysts in the liver and lung of the intermediate hosts [5]. The cyst structure consists of three layers including the germinal layer, laminated layer, and adventitial layer. Specifically, the adventitial layer is formed as a fibrotic tissue to isolate and limit the development of the parasitic cysts. In terms of parasites, it acts as a protective shell that separates the germinal layer from surrounding infiltrating immune cells [6]. In addition, it may also limit the efficacy of drugs targeting the parasite [7]. Research on the mechanism of liver fibrosis caused by infections from parasites is currently lacking. Therefore, elucidating the mechanism of fibrotic tissue caused by E. granulosus s.l. holds potential clinical significance not only for the treatment of CE, but for other parasitic diseases as well.
Ubiquitin-conjugating enzyme (E2) is one of the three key enzymes needed for ubiquitination of proteins. In eukaryotic genomes, there are 16–35 members of the E2 family [8]. Most E2s possess a highly conserved ubiquitin-conjugating domain known as the UBC domain, which facilitates the activation of ubiquitin/ubiquitin-like (Ub/Ubl) proteins in the presence of adenosine triphosphate (ATP) [9]. Ubiquitin is continuously transferred to the target protein, leading to the formation of mono-ubiquitination, multi-mono-ubiquitination, or poly-ubiquitination [10]. Mono-ubiquitination regulates various processes such as endocytosis, protein localization, and transport [11]. E2s determine the common Ub linkages in poly-ubiquitination, including Lys11, Lys48, and Lys63. Specifically, Lys11 and Lys48 chains are usually involved in proteasome degradation, while Lys63 chain participates in non-proteolytic processes, such as immune regulation, DNA repair, and signal transduction [12].
Currently, functional studies on parasite E2s are limited to Entamoeba histolytica [13], Trypanosoma brucei [14], and Trichinella spiralis [15]. For instance, the secretory proteins of Trichinella spiralis contains E2 Ub-conjugating activity, which is attributed to TsUBE2L3. Expression of TsUBE2L3 in mouse skeletal muscle cells leads to the down-regulation of protein ubiquitination, primarily affecting movement, sarcoma, and extracellular matrix (ECM) proteins, highlighting the significance of E2s in parasite–host interactions [15]. In this study, we screened EgE2D2 and EgE2N from E. granulosus proteomic data [16, 17]. The recombinant proteins were utilized for Western blotting, immunofluorescence localization, and secretory analysis, and their effects on the expression of fibrogenic genes, cell proliferation, and migration in TGFβ1-induced LX-2 were also investigated. Our findings provide a foundation for underlying the formation of fibrotic tissue in CE.
Methods
Animals and cell line
Nine female SD rats (4 weeks old) were purchased from Dashuo Experimental Animal (Chengdu, China; experimental animal production license no. SCXK 2020–030). They were provided with food pellets and sterilized water ad libitum. The immortalized human hepatic stellate cell line (LX-2, MeisenCTCC, China) was cultured in DMEM (Gibco, USA) supplemented with 10% (vol/vol) FBS (NEWZERUM, New Zealand) and 100 U/mL penicillin–streptomycin. The LX-2 cells were cultured at 37 °C in a humid atmosphere of 5% CO_2_, and the medium was changed every day.
Parasites, sera, tissue, and small extracellular vesicles
Hydatid cysts, hepatic tissue, protoscoleces (PSCs), and 25-day strobilated worms were provided by the Department of Parasitology, College of Veterinary Medicine, Sichuan Agricultural University. Healthy sheep livers and negative sera were obtained from sheep free of tapeworm infection. Following the method described in a previous study [17], fertile and sterile cysts were distinguished, meanwhile, hydatid fluid (HF) and germinal layer were aseptically isolated. The morphological characteristics of the samples were observed by hematoxylin–eosin staining (HE) (Additional file 1: Fig. S1). Small extracellular vesicles (sEV) originating from HF were isolated and identified according to previously described methods [18, 19]. The morphology and size of sEV were determined using transmission electron microscope and nanoparticle tracking analysis (Additional file 2: Fig. S2).
Bioinformatic analysis
For cloning and sequencing, primers were designed on the basis of the sequences in the GenBank database (EgE2D2: MK534430.1; EgE2N: XM_024494499.1). The sequenced EgE2D2 and EgE2N were further subjected to open reading frames (ORFs) prediction (https://www.ncbi.nlm.nih.gov/orffinder/), and basic physicochemical properties were predicted using the Expasy website (https://web.expasy.org/protparam/). Prediction of signal peptides and transmembrane regions was performed using SignalP 5.0 (http://www.cbs.dtu.dk/Services/SignalP/) and TMHMM 2.0 (http://www.cbs.dtu.dk/services/TMHMM-2.0), respectively. Subcellular localization and active site prediction were predicted using Cell-PLoc (http://www.csbio.sjtu.edu.cn/bioinf/Cell-PLoc-2/) and InterPro (http://www.ebi.ac.uk/interpro/), respectively. NPS (https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=/NPSA/npsa_sopma.html) and SWISS-MODEL (https://swissmodel.expasy.org/interactive) were utilized for secondary and tertiary structure predictions, respectively.
Production and purification of recombinant EgE2D2 and rEgE2N
Total RNA was extracted from PSCs using the RNAprep pure Tissue Kit (Tiangen, China) according to the manufacturer’s guidelines, and the Thermo Scientific RevertAid (Thermo Fisher Scientific, USA) was used to synthesize first-strand cDNA. The sequences of EgE2D2 and EgE2N were amplified with primers described in Table 1. Purified polymerase chain reaction (PCR) products were cloned into a pET32a (+) vector and transformed into E. coli BL21 (DE3). The BL21 strain was cultured at 37 °C, 160 rpm for 6 h, and then added with 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) to induce protein expression. Ni^2+^ affinity chromatography column (Bio-Rad, USA) was used to purify the recombinant proteins.Table 1. Primer sequencesGeneForward primer (5′-3′)Reverse primer (5′-3′)EgE2D2CGGATCCATGGCCCTGAAGAGGATTCCGGAATTCCTACATTGCGTACTTCTGAGTCCEgE2NCGAGCTCATGAGTGGACATCTTCCTACACCCTCGAGCTAGCGGAAGTCGGAAGα-SMAGACAGCTACGTGGGTGACGAATTTTCCATGTCGTCCCAGTTGCOL1A1GTGCGATGACGTGATCTGTGACGGTGGTTTCTTGGTCGGTCOL1A2GTTGCTGCTTGCAGTAACCTTAGGGCCAAGTCCAACTCCTTTIMP1TGCAGGATGGACTCTTGCACGCATTCCTCACAGCCAACAGGAPDHCAAGGTCATCCATGACAACTTTGGTCCACCACCCTGTTGCTGTAGBlack and bold italics signify restriction enzyme sites
Preparation of polyclonal antibody
Polyclonal antibodies against recombinant EgE2D2 (rEgE2D2) and EgE2N (rEgE2N) were prepared as previously described [20]. Briefly, rats were subcutaneously injected four times (at an interval of 1 week). The first immune reagent was 200 μg recombinant protein emulsified with equal volume of Freund’s complete adjuvant (Sigma, USA), and the booster reagent was 200 μg recombinant protein emulsified with equal volume of Freund’s incomplete adjuvant. Blood samples were collected to isolate antiserum, and the serum titer was determined by ELISA. Purification of immunoglobulin G (IgG) was performed using Protein G Resin FF Prepacked Column (GenScript, China), and purification efficiency was assessed by Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis (SDS-PAGE) analysis.
Western blotting analysis
The animal total protein extraction kit (Bestbio, China) and RIPA lysis buffer (Solarbio, China) were used for protein extraction of PSCs and LX-2 cells, respectively. After quantifying protein concentration using BCA kit (Bestbio, China), 20 μg of protein samples were separated in 12% SDS-PAGE gel and transferred to nitrocellulose membranes (Merck, Germany). The membrane was sealed with 5% skimmed milk at room temperature for 2 h, and then the primary antibodies, CE positive/negative sheep sera, polyclonal antibodies (anti-rEgE2D2 and rEgE2N), pre-immunized rat sera (1:200 v/v dilution), α-SMA, COL1A1, and GAPDH (1:5000 v/v dilution, ABclonal, China) were incubated overnight at 4 °C. After fully washing the membrane, corresponding horseradish peroxidase (HRP)-labeled secondary antibodies (goat anti-rat IgG, goat anti-rabbit IgG, and rabbit anti-sheep IgG (1:2000 v/v dilution, ABclonal, China) were added and incubated at room temperature for 1 h. Metal Enhanced DAB Substrate Kit (20 ×) (Solarbio, China) was used to visualize the bands.
Immunohistochemistry
Immunohistochemistry was performed following a previous protocol [20]. Slices of PSCs, 25-day strobilated worms, and fertile and sterile cyst walls were incubated overnight at 4 °C with anti-rEgE2D2/anti-rEgE2N rat IgG or pre-immunized rat serum (1:200 v/v dilution). Subsequently, the slices were incubated with fluorescein isothiocyanate (FITC)-conjugated goat anti-rat IgG (1:2000 dilution, Thermo Fisher Scientific, USA) at room temperature in the dark for 1 h. Nuclei were stained with DAPI (1 mg/mL, Solarbio, China) for 7 min. After each incubation, slices were washed with Phosphate Buffered Saline (PBS) for 5 min × four times. Finally, the slices were sealed with anti-fluorescence quenching agent and observed under Olympus fluorescence microscope (Olympus, Japan).
After the samples (infected and healthy liver tissue) were fixed, embedded, and sliced, and antigen retrieval was performed, 3% H_2_O_2_ was added and incubated at room temperature for 20 min. The primary antibody was incubated as described above, and the secondary antibody (a goat anti-rat IgG labeled with HRP, 1:2000 v/v dilution, ABclonal, China) was incubated at room temperature for 30 min. Fresh chromogenic liquid droplet prepared with Metal Enhanced DAB Substrate Kit (20×) was added to the tissue, and the brownish-yellow or brown color was observed under the microscope as a positive signal. The slices were immersed in hematoxylin dye solution for 3 min, then dehydrated and sealed.
Enzyme activity assay
To determine whether rEgE2D2 and rEgE2N have Ub conjugating activity, pET32a protein and Galectin were used as controls for ubiquitination in vitro. The addition amount of each component in the reaction system was carried out according to the previous description [21]. Non-reductive [Dithiothreitol (DTT) free] SDS loading buffer was added to the reaction solution and boiled for 5 min. Western blotting analysis was performed after 12% SDS-PAGE gel electrophoresis. The mouse anti-His tag mAb was used as primary antibody. The Ub conjugating activity of E2 was determined by the molecular weight of Ub.
Cell viability assay
Endotoxin Removal Kit (Smart-Lifesciences, China) was used to remove endotoxin from the recombinant proteins, and the concentration of endotoxin was determined according to ToxinSensor^™^ Chromogenic LAL Endotoxin Assay Kit (GenScript, China) to ensure that endotoxin level was below 0.02 EU/mL. Potential cytotoxic effects of recombinant proteins on LX-2 cells were evaluated by assessing cell viability using the Cell Counting Kit-8 (CCK-8, Beyotime, China) as described previously [22]. Briefly, 100 μL cell suspension (2 × 10^4^ cells) was added to the 96-well plate. After 24 h, different concentrations of recombinant protein (0, 10, 20, 40, 60, 80 μg/mL) were added and incubated at 37 °C for another 24 h. Subsequently, the culture medium was replaced with fresh medium, CCK-8 working solution was added and incubated at 37 °C for 1 h, and the absorbance was measured at 450 nm.
Cell activation assay
A total of 2 × 10^5^ cells were added to the 6-well plate. Once the cells reached 80% confluence, they were incubated with or without TGFβ1 (5 ng/mL) for 12 h, and then cultured with different concentrations of recombinant protein for 24 h [23]. The expression levels of fibrogenic genes (α-SMA, COL1A1, COL1A2, and TIMP1) were detected by quantitative reverse transcription (qRT)-PCR using the primers presented in Table 1. The qRT-PCR reaction mixture consisted of 12.5 μL TB Green^™^ Premix Ex Taq^™^ II (TaKaRa, Japan), 1 μL each primer, 2 μL cDNA, and 8.5 μL ddH_2_O. Samples were heated for 30 s at 95 °C and a two-step cycle (5 s at 95 °C, 60 s at 60 °C) was repeated for 40 cycles. The GAPDH (GenBank: DQ403057) gene was selected as the housekeeping gene, and the relative expression levels of fibrogenic genes were calculated using 2^−△△Ct^ method [24]. The protein expression levels of α-SMA and COL1A1 were detected by Western blotting. Image Lab 5.0 was used to determine the gray value, and GAPDH was employed as a loading control.
Cell proliferation and migration assays
Cell proliferation was evaluated by CCK-8 assay [25]. LX-2 cells were cultured in 96-well plate, incubated with 5 ng/mL TGFβ1 for 12 h, and then cultured with different concentrations of recombinant protein for 24 h. After replacing the culture medium, the absorbance was measured by adding CCK-8 working solution and incubating at 37 °C for 1 h at 450 nm.
Cell migration was evaluated using a 24-well transwell plate with 8.0 μm pore polycarbonate membrane insert, and 5 ng/mL TGFβ1 pre-stimulated cells were harvested and resuspended in the medium. A total of 3 × 10^4^ cells was loaded into the upper chamber, while the lower chamber filled 600 μL medium containing different concentrations of recombinant protein dissolved in PBS. The chamber was further incubated for 24 h at 37 °C. The staining and counting of the cells in five random regions were performed under optical microscope.
Statistics analysis
All data were presented as means ± standard deviation (SD) from multiple experiments. Statistics analysis was performed with Student’s t test method. P-values less than 0.05 were defined as the threshold for statistical significance. The significance levels were denoted as follows: *, P < 0.05; **, P < 0.01; ***, P < 0.001.
Results
Sequence analyses of EgE2D2 and EgE2N
The basic physical and chemical properties of EgE2D2 (kDa = 16) and EgE2N (kDa = 18) are presented in Table 2. The prediction of secondary structure and tertiary structure (Fig. 1A, B) revealed that they were similar in spatial structure, containing four α-helices and four β-folds, forming the UBC domain of E2. Both EgE2D2 and EgE2N belong to class I, indicating that their genetic biological function mainly depends on the UBC domain.Table 2. Basic physicochemical properties of EgE2D2 and EgE2NORF (bp)Amino acid (aa)Molecular weight (kDa)Isoelectric point (pI)Signal peptide/transmembrane domainSubcellular locationActive site (Cys)ClassificationEgE2D2444147166.39–/–N85IEgE2N486161186.83–/–C, N88IC cytoplasm, N nucleusFig. 1The three-dimensional (3D) structure of EgE2D2 A and EgE2N B and multiple sequences alignment of EgE2D2 C and EgE2N D. E. granulosus (NCBI: QEO33306.1); E. multilocularis (UniProt: A0A087VYI0); H. diminuta (UniProt: A0A0R3SUP0); H. microstoma (NCBI: CDS29458.1); H. taeniaeformis (NCBI: VDM16792.1); T. asiatica (NCBI: VDK24545.1); C. sinensis (NCBI: GAA57084.1); C. elegans (UniProt: P35129); T. adhaerens (UniProt: B3S643); H. sapiens (UniProt: P62837). (B) E. granulosus (NCBI: XP_024351120.1); E. multilocularis (NCBI: CDS35641.1); H. diminuta (NCBI: VUZ44905.1); H. microstoma (NCBI: CDS26822.1); H. taeniaeformis (NCBI: VDM34754.1); S. erinaceieuropaei (NCBI: VZI31528.1); T. asiatica (NCBI: VDK31863.1); C. sinensis (UniProt: G7YFT3); S. japonicum (UniProt: A0A4Z2DGS1); S. mansoni (UniProt: Q2MK73); A. suum (UniProt: F1KVF0); C. elegans (UniProt: Q95XX0); T. adhaerens (NCBI: XP_002111946.1); H. sapiens (UniProt: P61088). Identical amino acid residues are shaded blue; the darker the color, the more conservative the sequence
Sequence alignment (Fig. 1C, D) showed that EgE2D2 shared 100.0% identity with Taenia asiatica (T. asiatica) E2D2, and has 98.6%, 97.2%, 93.8%, and 91.8% similarity with Hymenolepis diminuta (H. diminuta) E2D2, Hymenolepis microstoma (H. microstoma) E2D2, Echinococcus multilocularis (E. multilocularis) E2D2, and Hydatigera taeniaeformis (H. taeniaeformis) E2D2. EgE2N shared 100.0% identity with E2N of E. multilocularis, by contrast, its homology compared with T. asiatica and H. taeniaeformis is 95.0% and 93.7%, respectively.
The phylogenetic analysis (Additional file 3: Fig. S3) showed that EgE2D2 and EgE2N are grouped together with E. multilocularis, T. asiatica, H. microstoma, and H. taeniaeformis, indicating their close evolutionary relationship. By contrast, EgE2D2 and EgE2N showed a distinct separation from trematodes and nematodes, and are more distantly related to mammals.
Expression, purification, and Western blotting of rEgE2D2 and rEgE2N
As expected, the molecular weights of rEgE2D2 and rEgE2N were about 34 kDa and 36 kDa, respectively (Fig. 2: Lanes 1, 2, 3, and 4). It should be noted that the pET-32a(+) tag proteins weigh about 18 kDa. Both proteins were expressed in a soluble protein. The purified antiserum IgG exhibited a heavy chain of 50 kDa and a light chain of 23 kDa (Fig. 2: Lane 5). Western blotting showed that both rEgE2D2 and rEgE2N could be specifically recognized by antiserum and sheep positive serum (Fig. 2: Lanes 6 and 8), indicating their strong immunoreactivity. In addition, anti-rEgE2D2 IgG and anti-rEgE2N IgG successfully recognized the natural protein in PSCs (Fig. 2: Lane 10). No bands appeared when the recombinant proteins were incubated with rat serum IgG, sheep negative serum, and PSCs crude protein incubated with rat serum IgG (Fig. 2: Lanes 7, 9, and 11).Fig. 2. Expression, purification, and Western blotting of rEgE2D2 and rEgE2N. M: Protein marker; (1) Protein of pET32a (+); (2) rEgE2D2/rEgE2N crude protein; (3) Purified rEgE2D2 and rEgE2N; (4) Purified pET32a (+) protein; (5) Purified rEgE2D2-IgG and rEgE2N-IgG; (6) Purified recombinant protein probed with rat polyclonal antibody; (7) Purified recombinant protein probed with pre-immunized rat serum; (8) Purified recombinant protein probed with serum from sheep naturally infected with E. granulosus; (9) Purified recombinant protein probed with non-infected sheep serum; (10) Total protein of PSCs probed with rat polyclonal antibody; (11) Total protein of PSCs probed with pre-immunized rat serum
Immunolocalization and secretory analysis of EgE2D2 and EgE2N
EgE2D2 and EgE2N exhibited a wide distribution in the germinal layer of the fertile cysts, mainly in the epidermis and hook in PSCs, while limited green fluorescence was observed in the sterile cysts. Notably, there were distinct differences in the distribution patterns of EgE2D2 and EgE2N in 25-day strobilated worms compared with PSCs. In 25-day strobilated worms, the fluorescence intensity of both EgE2D2 and EgE2N was weak and scattered (Fig. 3A, B).Fig. 3. Immunolocalization of EgE2D2 A and EgE2N B (×200)
Considering that EgE2D2 and EgE2N lack signal peptides for the classical secretory pathway, we further investigated whether they are vesicular structure-mediated secretion [26]. Transmission electron microscopy and nanoparticle tracking analysis showed that extracellular vesicles originating from HF exhibited a typical cup-shaped structure with sizes ranging from 74 nm to 184 nm (Additional file 2: Figure. S2), consistent with the characteristics of sEV. Western blotting demonstrated distinct bands in both fresh HF and HF without EgsEV, while no band was observed in EgsEV (Fig. 4A: Lines 4–9). Immunolocalization of EgE2D2 and EgE2N in the liver tissue of CE-infected sheep showed a strong brown signal at the junction of liver tissue and fibrous layer. By contrast, no positive signal was detected in the healthy liver tissue or negative control. These results indicated that EgE2D2 and EgE2N could be secreted into the liver tissue through a non-classical secretory pathway, possibly excluding small extracellular vesicles (Fig. 4B).Fig. 4. Analysis of secretory characteristics of EgE2D2 and EgE2N. A Western blotting analysis. M: Protein marker; (1) Fresh HF; (2) HF without EgsEV; (3) EgsEV; (4) Fresh HF probed with rat polyclonal antibody; (5) Fresh HF probed with pre-immunized rat serum; (6) HF without EgsEV probed with rat polyclonal antibody; (7) HF without EgsEV probed with pre-immunized rat serum; (8) EgsEV probed with rat polyclonal antibody; (9) EgsEV probed with pre-immunized rat serum. B Immunohistochemistry was used to analyze whether EgE2D2 and EgE2N were secreted into sheep liver (×200/×400)
rEgE2D2 and rEgE2N have ubiquitin binding activity
The molecular sizes of rEgE2D2, rEgE2N, pET32a, and Galectin were 34 kDa, 36 kDa, 18 kDa, and 52 kDa, respectively. The results (Fig. 5) showed that the polymer bands formed by the combination of rEgE2D2 or rEgE2N with multiple Ub were detected in the reaction solution with the coexistence of UBE1, EgE2, and Ub. pET32a and rGalectin did not form such polymer bands, indicating that rEgE2D2 and rEgE2N have Ub conjugating activity.Fig. 5. Detection of rEgE2D2 and rEgE2N enzyme activity. The red triangles indicate that the bands are mono-ubiquitinated or poly-ubiquitinated E2s. The asterisks indicate that the bands are unreacted recombinant proteins, and the other bands are impurity proteins
Toxicity analysis of recombinant proteins to LX-2 cells
After removing endotoxin from the recombinant proteins, the concentration of endotoxin was determined to be less than 0.01 EU/mL. To ensure subtoxic doses of the recombinant proteins, LX-2 cells were incubated with protein concentrations ranging from 0 μg/mL to 80 μg/mL for 24 h, and cytotoxic effects were evaluated by CCK-8 assay. As shown in Fig. 6, tolerated concentrations of cells were rEgE2D2 (10, 20 μg/mL) and rEgE2N (10, 20, 40 μg/mL), respectively. Moreover, higher concentrations of these proteins, as well as pET32a at 20 μg/mL, will also significantly inhibit cell growth.Fig. 6. Cell viability after treatment with rEgE2D2, rEgE2N, and pET32a. ‘*’ is the expression level of treatment group compared with control group
rEgE2D2 and rEgE2N promote the expression of fibrogenic genes in TGFβ1-induced LX-2
qRT-PCR results showed that TGFβ1 significantly increased the expression of α-SMA, COL1A1, COL1A2, and TIMP1 in LX-2 cells compared with the PBS group (Fig. 7A). Compared with the TGFβ1 treatment group, the addition of 10 μg/mL rEgE2D2, 10 μg/mL rEgE2N, and 20 μg/mL rEgE2N resulted in a significant increase in the expression of four fibrogenic genes. Additionally, the presence of 20 μg/mL rEgE2D2 could significantly upregulate the expression of three genes except for COL1A2.Fig. 7A qRT-PCR was used to detect the expression of pro-fibrogenic genes in LX-2 cells. ‘#’ is the expression level of the TGFβ1 group compared with the PBS group. B Western blotting was used to detect the expression of pro-fibrogenic genes in LX-2 cells
Western blotting showed that with the addition of TGFβ1, the protein expression of COL1A1 was significantly increased in the presence of 20 μg/mL rEgE2D2 or 10 μg/mL rEgE2N, whereas the expression of α-SMA was only increased in the rEgE2N groups at the concentrations of 20 μg/mL or 40 μg/mL (Fig. 7B). There was no significant difference in protein expression between the pET32a treated group and TGFβ1 group, indicating that specific concentrations of rEgE2D2 and rEgE2N could promote the protein expression of fibrosis-related genes in TGFβ1-induced LX-2 cells.
rEgE2D2 and rEgE2N promote the proliferation and migration of TGFβ1-induced LX-2
The proliferation and migration of activated hepatic stellate cells (HSCs) play an important role in the development of hepatic fibrosis [27]. Therefore, we used the CCK-8 assay to investigate the effects of rEgE2D2 and rEgE2N on the proliferation and migration of TGFβ1-induced LX-2 cells. Compared with the control group (Fig. 8A), rEgE2D2 and rEgE2N significantly promoted the proliferation of LX-2 cells induced by TGFβ1, whereas pET32a protein did not exhibit such effects. The chemotactic potential of rEgE2D2 and rEgE2N on TGFβ1-induced LX-2 cells was further investigated by using 24-well transwell plates. Compared with the PBS group, TGFβ1 treatment significantly increased the number of LX-2 cells migrating to the lower chamber (Fig. 8B, C). Importantly, compared with the TGFβ1 treatment group, both rEgE2D2 and rEgE2N significantly promote the migration of TGFβ1-induced LX-2 cells.Fig. 8. Effects of rEgE2D2 and rEgE2N on proliferation A and migration B&C of TGFβ1-induced LX-2 cells
Discussion
Ubiquitin-conjugating enzyme plays a central role in the ubiquitin–proteasome pathway: it receives the activated Ub at its front end and subsequently transfers the Ub to the target protein through ubiquitin ligase, thereby modulating the stability and activity of the target protein [28]. Most E2 enzymes possess a UBC domain that consists of approximately 150–200 amino acids, encompassing four α-helices and four β-folds [9]. The enzyme activity of E2 is dependent on the active site cysteine residue, which facilitates the binding and transfer of Ub [29]. Our findings demonstrate that EgE2D2 and EgE2N exhibit conserved amino acid sequences and tertiary structures, including intact UBC domains and active sites. These observations suggest that their biological functions may be similar to those found in mammals [30]. Furthermore, the ubiquitin-binding activity of rEgE2D2 and rEgE2N was confirmed by the ubiquitination experiment, indicating the recombinant molecules exhibit certain biological functions in vitro. Additionally, our study revealed the specific recognition of both rEgE2D2 and rEgE2N by CE-infected sheep serum, highlighting their strong reactivity and potential as diagnostic antigens.
Our results of immunofluorescence localization showed that EgE2D2 and EgE2N were widely distributed in the germinal layer of fertile cyst, epidermis, and hook of PSCs. Notably, the epidermis of tapeworm serves as a tissue for absorption of host nutrient, waste excretion, and signal transduction, which indicates that EgE2D2 and EgE2N may participate in these processes, and thereby contribute to the growth and development of PSCs [31]. Proteomic data have shown that both EgE2D2 and EgE2N are present in sheep-derived HF EV [16, 17], and we further confirmed that EgE2D2 and EgE2N were detected in sheep-derived HF while not in the sEV. This phenomenon may indicate that EgE2D2 and EgE2N were secreted through other EV subtypes such as large EV or exosomes. Immunofluorescence localization showed that EgE2D2 and EgE2N were mostly distributed in germinal layer and PSCs epidermis, providing favorable conditions for their secretion into HF. Furthermore, our immunohistochemistry results showed that EgE2D2 and EgE2N could enter the junction of liver tissue and fibrous layer after secretion, and their specific function and secretion pathway need to be explored in the future.
α-SMA is considered a marker of myofibroblasts, which exhibit wide distribution in muscle cells, and its expression regulates muscle contractile function. COL1A1 and COL3A1 are crucial components of ECM involved in cell migration, differentiation, and reflecting the process of fibrosis [32]. TIMP1, which is secreted by HSCs, could inhibit the activity of matrix metalloproteinases, thereby blocking the degradation of collagen and promoting fibrosis formation [33]. These fibrogenic genes play an essential role in reflecting the fibrosis progression, as evidenced by the overall increasing trend in their expression levels in TGFβ1-induced LX-2 cells on the basis of qRT-PCR experiment. Furthermore, higher expression levels of fibrogenic genes were observed in TGFβ1-induced LX-2 cells with the addition of rEgE2D2 or rEgE2N. However, when considering the results of Western blotting experiments, the differential expression of α-SMA and COL1A1 proteins may be attributed to rEgE2D2 or rEgE2N degrading excessive amounts of proteins necessary for normal cellular function. As for cellular function, both rEgE2D2 and rEgE2N could promote the proliferation and migration of TGFβ1-induced LX-2 cells, indicating that the entry of EgE2D2 and EgE2N into the liver tissue facilitated hepatic fibrosis development. Extensive adventitial layer fibrosis provides mechanical support for fluid-filled cysts, which is usually considered as a mechanism by which the host restricts the growth and infection of metacestode. However, recent studies conducted in experimental mice have shown that IL-17A could reduce fibrosis, resulting in a reduction in parasite numbers [34, 35]. This evidence suggests that fibrotic response is related to the survival of parasites, and the regulation of fibrosis formation by specific proteins such as EgE2D2 and EgE2N is necessary for the development of hydatid cysts.
It was reported that HF could significantly promote the expression of α-SMA, COL1A1, and the proliferation of LX-2 cells, indicating that the parasite components in HF participated in the development of liver fibrosis by activating HSCs [36]. Our study further demonstrated that EgE2D2 and EgE2N are secreted into the HF and participate in the process of liver fibrosis by enhancing the expression of fibrosis-related genes and promoting the growth as well as migration of LX-2 cells. Ubiquitination is considered to be an important regulator of TGFβ signaling pathway by regulating Smads, and the specific mechanism of TGFβ1 activation in LX-2 cells involves the function of E2s: the activated TGFβ1 signal is transferred to Smads protein through homologous receptors, thus enhancing the transcription of fiber-forming genes [37, 38]. On the basis of this information, we speculate that EgE2D2 and EgE2N may promote fibrosis by promoting the signal transduction of TGFβ1. It is important to note that the interaction and mutual regulation among the ECM, cells, and cytokines in liver fibrosis formation are highly complex. Further studies are required to explore the specific mechanisms through which EgE2D2 and EgE2N promote liver fibrosis in TGFβ1-induced LX-2 cells.
Supplementary Information
Additional file 1: Figure S1. The HE staining of samples. (A): Sterile cyst, fertile cyst, PSC, and 25-day strobilated worm (HE × 200); (B): Fertile cyst and surrounding liver tissue (HE × 400); (C): Healthy liver tissue (HE × 200). Abbreviations: G, germinal layer; H, hooks; S, suckers; Sc, scolex.**Additional file 2: Figure S2. **Transmission electron microscopy (A) and nanoparticle tracking analysis (B) of extracellular vesicles originating from HF.**Additional file 3: Figure S3. **The phylogenetic tree (ML) of EgE2D2 and EgE2N.
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1Deplazes P Rinaldi L Alvarez Rojas CA Torgerson PR Harandi MF Romig T Global distribution of alveolar and cystic echinococcosis Adv Parasitol 20179531549310.1016/bs.apar.2016.11.00128131365 · doi ↗ · pubmed ↗
- 2Wen H Vuitton L Tuxun T Li J Vuitton DA Zhang W Echinococcosis: advances in the 21st century Clin Microbiol Rev 201932 e 00075 e 11810.1128/CMR.00075-1830760475 PMC 6431127 · doi ↗ · pubmed ↗
- 3World Health Organization & Food and Agriculture Organization of the United Nations Multicriteria-based ranking for risk management of food-borne parasites: report of a Joint FAO/WHO expert meeting, 3–7 September 20122014 Rome FAO Headquarters
- 4World Health Organization Ending the neglect to attain the sustainable development goals: a road map for neglected tropical diseases 2021–20302020 Geneva WHO
- 5Thompson RCA Biology and systematics of Echinococcus Adv Parasitol 2017956510910.1016/bs.apar.2016.07.00128131366 · doi ↗ · pubmed ↗
- 6Hidalgo C Stoore C Strull K Franco C Corrêa F Jiménez M New insights of the local immune response against both fertile and infertile hydatid cysts P Lo S ONE 201914 e 021154210.1371/journal.pone.021154230699191 PMC 6353198 · doi ↗ · pubmed ↗
- 7Vuitton DA The ambiguous role of immunity in echinococcosis: protection of the host or of the parasite?Acta Trop 20038511913210.1016/S 0001-706X(02)00230-912606089 · doi ↗ · pubmed ↗
- 8van Wijk SJ Timmers HT The family of ubiquitin-conjugating enzymes (E 2s): deciding between life and death of proteins FASEB J 20102498199310.1096/fj.09-13625919940261 · doi ↗ · pubmed ↗
