Lake Erie ice is a repository of organisms

TL;DR

This paper explores the variety of organisms found in ice from Lake Erie using genetic data.

Contribution

The study reveals the diversity of organisms trapped in Lake Erie ice through metagenomic and metatranscriptomic analysis.

Findings

Lake Erie ice contains a high abundance of bacterial organisms.

Eukaryotic and archaeal organisms were also identified in the ice samples.

The analysis identified organisms from 32 bacterial, 8 eukaryotic, and 2 archaeal taxonomic groups.

Abstract

Organism abundance and diversity were assessed in Lake Erie ice samples using sequences derived from a combined metagenomic and metatranscriptomic analysis. The 68,417 unique sequences were from Bacteria (77.5%), Eukarya (22.3%), and Archaea (0.2%) and indicated diverse species of organisms from 32 bacterial, 8 eukaryotic, and 2 archaeal taxonomic groups.

Figures

Abundance of Bacteria and Eukarya. (A) Total numbers of unique sequences (DNA and RNA) from each major taxon of Bacteria. Those with fewer than 20 sequences (not shown in the figure) were from Aquificae, Armatimonadetes, Caldisericia, Chlorochromatium, Chrysiogenetes, Cloacimonetes, Deferribacderes, Elusimicrobia, Fibrobacteres, Synergistota, Thermodesulfobacteriota, and Zetaproteobacteria. (B) Total numbers of unique sequences (DNA and RNA) from each major taxon of Eukarya. Those with fewer than 20 sequences (not shown in the figure) were from Acanthocephala, Blastocladiomycota, Brachiopoda, Bryozoa, Ctenophora, Echinodermata, Entorrhizomycota, Glaucophyta, Kinorhyncha, Nemertea, Placozoa, Phoronida, Pripulida, Spinuncula, and Xenacoelomorpha.

Tables

TABLE 1. Total number of species by major taxon, based on top BLAST matches to DNA and RNA sequences

Domain	Major taxon	Number of species
Archaea	Euryarchaeota	19
	Thaumarchaeota	5
Bacteria	Acidobacteria	16
	Actinomycetes	228
	Armatimonadetes	2
	Aquificae	7
	Bacteroidetes	157
	Caldisericia	1
	Chlorobi	2
	Chlorochromatium	1
	Chloroflexi	16
	Chlamydia	14
	Chrysiogenetes	1
	Cloacimonetes	1
	Cyanobacteria	170
	Deferribacteres	3
	Deinococcus-Thermus	14
	Elusimicrobia	1
	Endomicrobia	1
	Fibrobacteres	1
	Firmicutes	270
	Fusobacter	9
	Gemmatimonadetes	1
	Lentisphaerae	2
	Nitrospira	6
	Planctomycetes	22
	Proteobacteria
	Alphaproteobacteria	282
	Betaproteobacteria	270
	Deltaproteobacteria	98
	Gammaproteobacteria	427
	Zetaproteobacteria	1
	Solibacteres	3
	Spirochaetia	25
	Synergistia	5
	Tenericutes	24
	Thermodesulfobacteria	3
	Thermotogae	18
	Verrucomicrobia	18
Eukarya	Amoebozoa	19
	Apusozoa	5
	Archaeplastida
	Anthrocerotophyta	1
	Bryophyta	8
	Chlorophyta	90
	Gnetophyta	1
	Lycophyta	1
	Marchantiophyta	2
	Polypodiophyta	2
	Rhodophyta	10
	Streptophyta	43
	Excavata	28
	Hacrobia
	Centroheliozoa	1
	Cryptophyta	9
	Opisthokonta
	Fungi
	Ascomycota	72
	Basidiomycota	37
	Blastoclatiomycetes	1
	Chytridiomycota	10
	Crisidiscoidea	1
	Glomeromycota	4
	Kickxellomycota	1
	Microsporidia	1
	Mucoromycota	4
	Zygomycota	6
	Animalia
	Annelida	12
	Arthropoda	87
	Brachiopoda	1
	Bryozoa	2
	Choanoflagellates	6
	Chordata	41
	Cnidaria	68
	Ctenophora	2
	Echinodermata	1
	Filasterea	1
	Gastrotrichia	3
	Kinorhyncha	1
	Mollusca	44
	Nematoda	16
	Nematomorpha	2
	Nemertea	3
	Phoronida	1
	Platyhelminthes	21
	Porifera	9
	Priapulida	2
	Rotifera	17
	Sipuncula	1
	Tardigrada	4
	Xenacoelomorpha	4
	SAR
	Alveolata	34
	Rhizaria	35
	Stamenopiles	96

Full text

ANNOUNCEMENT

Lake ice entraps enormous numbers of microbes, many of which remain viable (1–8). As the ice melts, the organisms are released into the water, potentially adding to the biodiversity in the lakes. Dead organisms provide carbon sources for the living organisms in the lake water. While lake water has been studied extensively (9–20), few such studies have been conducted on lake ice. Here, we report details of DNA and RNA sequences from Lake Erie ice.

A full-thickness surface ice sample (30 × 30 × 45 cm) was collected from Station 84 (42.05 N, −81.55 W) in the central basin of Lake Erie in January 2010. A subsample (8 × 8 × 15 cm) was immersed in 5% sodium hypochlorite, then rinsed with 2.0 L of sterile reverse osmosis purified water (18 MΩ, <1 ppm total organic carbon) followed by melting at room temperature in a sterile funnel and collected in sterile 50 mL screwcap tubes that were immediately frozen at −20°C. A total of 250 mL was thawed and subjected to ultracentrifugation (100,000 × g for 16 h at 4°C) to concentrate cells and nucleic acids. Pellets were rehydrated in 50 µL of sterile 0.1× TE [1 mM Tris (pH 7.5), 0.1 mM EDTA, 4°C], details described previously (3, 7, 8).

Nucleic acid extraction was performed using MinElute Spin Columns (QIAGEN, Valencia, CA, USA). The eluted nucleic acids were precipitated in ethanol, pelleted, dried, and rehydrated in 10 µL of 0.1× TE. DNA copies of the RNA were produced with a cDNA kit using random hexamer primers (Invitrogen SuperScript Choice System, Invitrogen, Grand Island, NY, USA). The resulting solution contained both DNA (metagenomic portion) and cDNA (metatranscriptomic portion). Adapters (AATTCGCGGCCGCGTCGAC, dsDNA) were ligated to each end of the cDNA and DNA using T4 DNA ligase. For pyrosequencing, 454-specific primers, one with 454 sequence A (underlined): CGTATCGCCTCCCTCGCGCCATCAGAATTCGCGGCCGCGTCGAC and the other with 454 sequence B (underlined): CTATGCGCCTTGCCAGCCCGCTCAGAATTCGCGGCCGCGTCGAC, were added to the nucleic acids using PCR (4 min at 94°C, followed by 40 cycles of 1 min at 94°C, 2 min at 55°C, 72°C, followed by 10 min at 72°C). The amplified nucleic acids were quantified on agarose gels and subjected to sequencing using a 454 GS Junior System (Roche Corporation, Indianapolis, IN, USA) by Roche staff, who also performed sequence filtering to extract high-quality reads (eliminating duplicates, reads < 20 nt, and reads > 20% ambiguous nucleotides). This reduced the reads from a total of 122,460 to 68,417 high-quality reads, with mean lengths of 390 nt. High-quality reads were subjected to MegaBLAST analysis, using a cut-off e-value of 10^−10^. Default parameters were used for all software. Taxonomic assignments were made based on the top BLAST matches. When the top BLAST match was taxonomically unknown, the next sequence within the top 10 that had a taxonomic designation was chosen. The number of sequences and the species abundances in each major taxonomic group were determined (Fig. 1; Table 1). Additional details were reported elsewhere (21).

Abundance of Bacteria and Eukarya. (A) Total numbers of unique sequences (DNA and RNA) from each major taxon of Bacteria. Those with fewer than 20 sequences (not shown in the figure) were from Aquificae, Armatimonadetes, Caldisericia, Chlorochromatium, Chrysiogenetes, Cloacimonetes, Deferribacderes, Elusimicrobia, Fibrobacteres, Synergistota, Thermodesulfobacteriota, and Zetaproteobacteria. (B) Total numbers of unique sequences (DNA and RNA) from each major taxon of Eukarya. Those with fewer than 20 sequences (not shown in the figure) were from Acanthocephala, Blastocladiomycota, Brachiopoda, Bryozoa, Ctenophora, Echinodermata, Entorrhizomycota, Glaucophyta, Kinorhyncha, Nemertea, Placozoa, Phoronida, Pripulida, Spinuncula, and Xenacoelomorpha.