Palindromic Decompositions with Gaps and Errors
Micha{\l} Adamczyk, Mai Alzamel, Panagiotis Charalampopoulos, Costas, S. Iliopoulos, and Jakub Radoszewski

TL;DR
This paper introduces algorithms for decomposing sequences into palindromes allowing gaps and errors, with applications in computational biology and combinatorics, optimizing for minimal total gap length under various constraints.
Contribution
It extends existing palindrome decomposition algorithms to include gaps, errors, and length bounds, providing efficient solutions for complex sequence analysis.
Findings
Algorithm for minimal gap length decomposition with gaps in O(n log n * g) time.
Algorithm for -palindrome decomposition with gaps and errors in O(n (g + )) time.
Applicable to biological sequence analysis and combinatorics on words.
Abstract
Identifying palindromes in sequences has been an interesting line of research in combinatorics on words and also in computational biology, after the discovery of the relation of palindromes in the DNA sequence with the HIV virus. Efficient algorithms for the factorization of sequences into palindromes and maximal palindromes have been devised in recent years. We extend these studies by allowing gaps in decompositions and errors in palindromes, and also imposing a lower bound to the length of acceptable palindromes. We first present an algorithm for obtaining a palindromic decomposition of a string of length n with the minimal total gap length in time O(n log n * g) and space O(n g), where g is the number of allowed gaps in the decomposition. We then consider a decomposition of the string in maximal \delta-palindromes (i.e. palindromes with \delta errors under the edit or Hamming…
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsAlgorithms and Data Compression · semigroups and automata theory · DNA and Biological Computing
Palindromic Decompositions with Gaps and Errors
Michał Adamczyk
Institute of Informatics, University of Warsaw, Warsaw, Poland
[michal.adamczyk,jrad]@mimuw.edu.pl
Mai Alzamel
Department of Informatics, King’s College London, London, UK
[mai.alzamel,panagiotis.charalampopoulos,costas.iliopoulos]@kcl.ac.uk
Panagiotis Charalampopoulos
Department of Informatics, King’s College London, London, UK
[mai.alzamel,panagiotis.charalampopoulos,costas.iliopoulos]@kcl.ac.uk
Costas S. Iliopoulos
Department of Informatics, King’s College London, London, UK
[mai.alzamel,panagiotis.charalampopoulos,costas.iliopoulos]@kcl.ac.uk
Jakub Radoszewski
Institute of Informatics, University of Warsaw, Warsaw, Poland
[michal.adamczyk,jrad]@mimuw.edu.pl
Department of Informatics, King’s College London, London, UK
[mai.alzamel,panagiotis.charalampopoulos,costas.iliopoulos]@kcl.ac.uk
Abstract
Identifying palindromes in sequences has been an interesting line of research in combinatorics on words and also in computational biology, after the discovery of the relation of palindromes in the DNA sequence with the HIV virus. Efficient algorithms for the factorization of sequences into palindromes and maximal palindromes have been devised in recent years. We extend these studies by allowing gaps in decompositions and errors in palindromes, and also imposing a lower bound to the length of acceptable palindromes.
We first present an algorithm for obtaining a palindromic decomposition of a string of length with the minimal total gap length in time and space , where is the number of allowed gaps in the decomposition. We then consider a decomposition of the string in maximal -palindromes (i.e. palindromes with errors under the edit or Hamming distance) and allowed gaps. We present an algorithm to obtain such a decomposition with the minimal total gap length in time and space .
1 Introduction
A palindrome is a symmetric word that reads the same backward and forward. The detection of palindromes is a classical and well-studied problem in computer science, language theory and algorithm design with a lot of variants arising out of different practical scenarios. String and sequence algorithms related to palindromes have long drawn the attention of stringology researchers [4, 12, 19]. Interestingly, in the seminal Knuth-Morris-Pratt paper presenting the well-known string matching algorithm [18], a problem related to palindrome recognition was also considered. In combinatorics on words, for example, studies have investigated the inhabitation of palindromes in Fibonacci words or Sturmian words in general [7, 8]. There is also an interesting conjecture related to periodicity of infinite strings whose every factor can be decomposed into a bounded number of palindromes [10].
In computational biology, palindromes play an important role in regulation of gene activity and other cell processes because these are often observed near promoters, introns and specific untranslated regions. Hairpins (also called complemented palindromes) in the HIV virus are strings of the form , where is the reverse complement of , while (even) palindromes are strings of the form . Algorithms for detecting palindromes can often be adapted to compute hairpins as well. Hence, we can identify palindromes in the DNA sequence and then align the part of the DNA sequence that contains them with the HIV virus.
In the beginnings of algorithmic study of palindromes, Manacher discovered an on-line sequential algorithm that finds all initial palindromes in a string [21]. A string is said to have an initial palindrome of length if is a palindrome. Later Apostolico et al. observed that the algorithm given by [21] is able to find all maximal palindromic factors in the string in time [3]. Gusfield gave another linear-time algorithm to find all maximal palindromes in a string [15]. He also discussed the relation between biological sequences and gapped (separated) palindromes (i.e. strings of the form ). Gupta et al. [14] presented an -time algorithm to compute specific classes—based on length constraints—of such palindromes. Algorithms for finding the so-called gapped palindromes were also considered in [11, 19]. (In our study, we consider gaps between palindromes, not inside them.)
A problem that gained significant attention recently was decomposing a string into a minimal number of palindromes; any such decomposition is called a palindromic factorization. Fici et al. [9] presented an on-line -time algorithm for computing a palindromic factorization of a string of length . A similar on-line algorithm was presented by I et al. [17] as well as an on-line algorithm with the same time complexity to factorize a string into maximal palindromes. Alatabbi et al. gave an off-line -time algorithm for the latter problem [2]. In addition, Rubinchik and Shur [23] devised an -sized data structure that helps locate palindromes in a string; they also show how it can be used to compute the palindromic factorization of a string in time.
A similar problem, first studied by Galil and Seiferas in [13], asked whether a given string can be decomposed into palindromes. Galil and Seiferas [13] presented an on-line -time algorithm for and an off-line -time algorithm for . In 2014, Kosolobov et al. presented an on-line -time algorithm to decide this for arbitrary [20].
Our work is a continuation of this line of research, motivated by possible errors and inconsistencies in the biological data. We extend the previous work by introducing a constraint on the length of the palindromes and allowing gaps and errors in the decompositions. By gaps we mean regions of the string that are not decomposed into palindromes of sufficient length. We allow errors in the palindromes, so that a palindrome with errors is a string having a small Hamming or edit distance from an ideal palindrome. We present two approaches for decomposing a string into sufficiently long palindromes; one allowing only gaps in the decomposition and the other allowing both gaps in the decomposition and errors in the palindromes. We first present an algorithm that computes a palindromic decomposition with the minimal total gap length of a string of length in time and space , where is the number of allowed gaps. Secondly, we present an -time and -space algorithm for the decomposition of a string of length into maximal palindromes with at most errors each, under the Hamming or edit distance, and allowed gaps. The algorithms can be applied for both standard and complemented palindromes.
Our first result is a multistage generalization of the algorithm computing a palindromic factorization from [9]. We show that their approach can be extended to handle gaps, a constraint on the length of palindromes, and complemented palindromes as well. In our second result, the first step is the computation of maximal palindromes with at most errors each and the second step is a dynamic programming approach that takes as input these maximal palindromes and returns a decomposition of the string with the minimal total gap length. An computation of maximal palindromes under the Hamming distance was presented in [15]. We present an equally efficient approach for computing all maximal palindromes under the edit distance. After our conference publication [1], we have learnt about alternative algorithms computing this type of maximal approximate palindromes [22, 16]. The approach of [22] works in time. The algorithm from [16] has same time complexity as ours (), however, it is much more complex, as it was designed for a more general problem.
2 Notation and terminology
Let be a string of length over an alphabet . We consider the case of an integer alphabet; in this case each letter can be replaced by its rank so that the resulting string consists of integers in the range . For two positions and , where , in , we denote the factor of by . We denote the reverse string of by , i.e. . The empty string (denoted by ) is the unique string over of length 0. A string is said to be a palindrome if and only if . If is a palindrome, the number is called the center of . Let , where , be a palindromic factor in . It is said to be a maximal palindrome if there is no longer palindrome in with center . Note that a maximal palindrome can be a factor of another palindrome.
Definition 1**.**
We say that is a (maximal) palindromic decomposition of if all the strings are (maximal) palindromes.
Definition 2**.**
A (maximal) palindromic decomposition of such that the number of (maximal) palindromes is minimal is called a (maximal) palindromic factorization of .
Note that any single letter is a palindrome and, hence, every string can always be decomposed into palindromes. However, not every string can be decomposed into maximal palindromes; e.g. consider [2].
Let be an involution on the alphabet , i.e., a function such that . We extend into a morphism on strings over . We say that a string is a generalized palindrome if . Two known notions fit this definition:
- •
If , then a generalized palindrome is a standard palindrome.
- •
If and , , , , then a generalized palindrome corresponds to a so-called complemented palindrome [15].
Example 1**.**
The string is a standard palindrome and the string is a complemented palindrome.
We also consider (generalized) palindromes with errors. Let us recall two well-known metrics on strings. Let and be two strings. If , then the Hamming distance between and is the number of positions where and do not match. The edit (or Levenshtein) distance between and is the minimum number of edit operations (insertions, deletions, substitutions) needed to transform into . We say that is a generalized -palindrome under the Hamming distance (or the edit distance) if the minimum Hamming distance (edit distance, respectively) from to any generalized palindrome is at most .
A generalized palindrome is called maximal if there is no longer generalized palindrome with the same center. Similarly, a generalized -palindrome under the Hamming/edit distance is called maximal if there is no longer generalized -palindrome under the same distance measure with the same center.
Example 2**.**
All maximal 0-palindromes/1-palindromes in (for ) under the Hamming and under the edit distance are as follows:
[TABLE]
For instance, the whole string GTATCG is a 1-palindrome under the edit distance, as deleting its fifth letter yields a palindrome GTATG.
The computational problems we study can be formally stated as follows.
Generalized Palindromic Decomposition with Gaps
Input: A string of length , an involution , and integers
Output: A decomposition of into generalized palindromes with the minimal possible total length of gaps, , such that:
•
There are at most gaps, i.e.
•
Each palindrome is of length at least
Generalized Maximal -Palindromic Decomposition with Gaps
Input: A string of length , an involution , and integers
Output: A decomposition of into maximal generalized -palindromes with the minimal possible total length of gaps, , such that:
•
There are at most gaps, i.e.
•
Each generalized -palindrome is of length at least
We apply several instances of dynamic programming. For simplicity of presentation, we only show how to compute the minimal total length of gaps and omit describing the retrieval of the decomposition itself. To compute the latter, in each of the dynamic programming matrices we would store a pointer to the cell that gave us the minimum value so that we could actually compute the decomposition with the minimal total length of the gaps by backtracing.
3 Palindromic decomposition with gaps
In this section we develop an efficient solution to the Generalized Palindromic Decomposition with Gaps problem. It is based on several transformations of the algorithm for computing a palindromic factorization by Fici et al. [9]. For a string of length this algorithm works in time. The algorithm consists of two steps:
Let be the sorted list of starting positions of all palindromes ending at position in . This list may have size . However, it follows from combinatorial properties of palindromes that the sequence of consecutive differences in is non-increasing and contains at most distinct values. Let be the maximal sublist of containing elements whose predecessor in is smaller by exactly . Then there are such sublists in . Hence, can be represented by a set of size which consists of triples of the form that represent . The triples are sorted according to decreasing values of and all starting positions in each triple are greater than in the previous one. Fici et al. show that can be computed from in time. 2. 2.
Let denote the number of palindromes in a palindromic factorization of . Fici et al. show that it can be computed via a dynamic programming approach, using all palindromes from in time. Their algorithm works as follows. Let be the minimum number of palindromes we can decompose in, provided that we use a palindrome from . Then can be computed in constant time using based on the fact that if and , then . Exploiting this fact, can be computed by only considering and the shortest palindrome in . Finally, we compute from all such values.
In Appendix A we show for completeness that the same approach works for generalized palindromes for any involution .
To solve the Generalized Palindromic Decomposition with Gaps problem, we first need to modify each of the triples in to reflect the length constraint (). More precisely, due to the length constraint, in each some triples will disappear completely, and at most one triple will get trimmed (i.e. the parameter will be decreased).
Our algorithm then computes an array such that is the minimum possible total length of gaps in a palindromic decomposition of , provided that there are at most gaps. Simultaneously, our algorithm computes an auxiliary array such that is the minimum possible total length of gaps up to position provided that this position belongs to a gap: at most the -th one.
For and we have the following formula:
[TABLE]
where is the partial minimum computed only using generalized palindromes from . The formula means: either we have a gap at position , or we use a generalized palindrome ending at position . We also set for any .
We compute for using the same approach as Fici et al. [9] used for , ignoring the triples that disappear due to the length constraint. If there is a triple that got trimmed, then the corresponding triple at position (from which we reuse the values in the dynamic programming) must have got trimmed as well. More precisely, if the triple is trimmed to at position , then at position there is a triple which is trimmed to ; that is, by the same number of generalized palindromes. Consequently, to compute from , we need to include one additional generalized palindrome (the shortest one in the triple) just as in Fici et al.’s approach.
Example 3**.**
Consider the string AACCAACCAACCAACCAA, , and let .
AACCAACCAACCAACCAA123456789101112131415161718
Then , where:
- •
represents the whole string,
- •
represents which will get trimmed by 2 palindromes due to the length constraint, becoming ,
- •
represents and disappears.
Now looking at position for the trimmed group, we had representing , and this also gets trimmed by palindromes, becoming .
Finally, for and we compute using the following formula:
[TABLE]
The first case corresponds to continuing the gap from position , whereas the second to using a generalized palindrome finishing at position or a gap finishing at position (the latter will be suboptimal). Here the border cases are for and for .
Thus we arrive at the complete solution to the problem.
Theorem 1**.**
The Generalized Palindromic Decomposition with Gaps problem can be solved in time and space.
4 Computing maximal palindromes with errors
Recall that all maximal (standard) palindromes in a string can be computed in time by Manacher’s [6, 21] and Gusfield’s [15] algorithms. These algorithms perform different computations for odd- and for even-length palindromes. Recall that we defined the centers of odd-length palindromes as integers and the centers of even-length palindromes as odd multiples of .
Gusfield’s algorithm [15] applies Longest Common Extension (LCE) Queries in the string T=S\S^{R}$\not\in\SigmaLCE(i,j)T[i\mathinner{\ldotp\ldotp}|T|]T[j\mathinner{\ldotp\ldotp}|T|]ii+1LCE(i+1,2n+2-i)T\mathcal{O}(1)$ time after linear-time preprocessing [5].
Gusfield’s approach can be easily adapted to generalized palindromes: it suffices to apply LCE-queries on T=S\f(S^{R})LGPal(i,j)kf(S[i-k+1\mathinner{\ldotp\ldotp}i]^{R})=S[j\mathinner{\ldotp\ldotp}j+k-1]; see Fig. [1](#S4.F1). As we have already noticed, LGPal-queries are equivalent to LCE-queries in T=S$f(S^{R})$.
It is known (see [15]) that all maximal generalized -palindromes under the Hamming distance can be computed in time via at most applications of the LGPal-query for each possible center position. Below we show how to compute maximal generalized -palindromes under the edit distance within the same time complexity.
Recall that if is a generalized -palindrome under the edit distance, then there exists a generalized palindrome such that the minimal number of edit operations (insertion, deletion, substitution) required to transform to is at most . The following simple observation shows that we can restrict ourselves to deletions and substitutions only, which we call in what follows the restricted edit operations. Intuitively, instead of inserting at position a character to match the character at position , we can delete the character at position .
Observation 1**.**
Let be a generalized -palindrome and a generalized palindrome such that the edit distance between and is minimal. Then there exists a generalized palindrome such that the number of restricted edit operations needed to transform to is equal to the edit distance between and .
We can extend a maximal generalized -palindrome to a maximal generalized -palindrome in three ways; either ignore the letter and then perform an LGPal-query, or ignore the letter and then perform an LGPal-query, or ignore both and then perform the LGPal-query. More formally:
Definition 3**.**
Assume that is a generalized -palindrome. Then we say that each of the factors for:
- •
, , where
- •
, , where
- •
, , where
is an extension of . If the index is smaller than 1 or the index is greater than , the corresponding extension is not possible. We also say that can be extended to any of the three strings .
Clearly, the extensions of a generalized -palindrome are always generalized -palindromes.
To facilitate the case of -palindromes being prefixes or suffixes of the text, we also introduce the following border-reductions for being a generalized -palindrome:
- •
If , a border reduction leads to .
- •
If , a border reduction leads to .
If any of the reductions is possible, we also say that can be border-reduced to the corresponding strings. As previously, border-reductions of a generalized -palindrome are always generalized -palindromes.
Lemma 1**.**
Given a maximal generalized -palindrome with , there exists a maximal generalized -palindrome which can be extended or border-reduced to .
Proof.
Consider a shortest sequence of restricted edit operations that transforms into a generalized palindrome . Let us consider the position where we perform a restricted edit operation that is closest to or . Assume w.l.o.g. that this position—denote it by —is not further to than to .
Assume first that this edit operation is a substitution. Then , for and , is a generalized -palindrome (the witness generalized palindrome is the corresponding factor of ); see Fig. 2. Moreover, it is a maximal generalized -palindrome, as otherwise would be equal to , which means that the substitution at the position would not be necessary. This completes the proof in this case.
Now assume that the edit operation at the position was a deletion. Let and . Again, we see that clearly is a generalized -palindrome. If it is maximal, then we are done. Otherwise, consider the maximal generalized -palindrome centered at the same position as (). Now we have three cases; see Fig. 3.
If , then we can obtain by an extension (of the first type) of ; i.e. ignoring the letter . 2. 2.
If , then we have that is a generalized -palindrome. If, additionally, , then is a generalized -palindrome, which contradicts the maximality of . 3. 3.
Finally, if and , then , . Hence, obtained from by a border-reduction.
This completes the proof of the lemma. ∎
The combinatorial characterization of Lemma 1 yields an algorithm for generating all maximal generalized -palindromes, for all centers and subsequent . Maximal generalized 0-palindromes are computed using Gusfield’s approach (LGPal-queries). For a given , we consider all the maximal generalized -palindromes and try to extend each of them in all three possible ways (and border-reduce, if possible). This way we obtain a number of generalized -palindromes amongst which, by Lemma 1, are all maximal generalized -palindromes. To exclude the non-maximal ones, we group the generalized -palindromes by their centers (in time via bucket sort) and retain only the longest one for each center. We arrive at the following intermediate result.
Lemma 2**.**
Under the edit distance, all maximal generalized -palindromes in a string of length can be computed in time and space.
5 Maximal palindromic decomposition with gaps and errors
Let be a set of factors of the text . In this section we develop a general framework that allows to decompose into factors from , allowing at most gaps. We call such a factorization a -factorization of . Our goal is to find a -factorization of that minimizes the total length of gaps. We aim at the time complexity and space complexity .
In our solution we use dynamic programming to compute two arrays, similar to the ones used in Section 3:
: is the minimum total length of gaps in a -factorization of .
: is the minimum total length of gaps in a -factorization of for which the position belongs to a gap.
We use the following formulas, for and :
[TABLE]
The border cases are exactly the same as in Section 3.
Clearly, the space complexity of this solution is . Let us analyze its time complexity. Fix . The number of transitions using the factors from in the dynamic programming is in total, as each factor is used only for the position where it ends. Hence, the formulas for take time to evaluate. Computing the values takes time. Thus we arrive at the desired time complexity of .
We apply this approach to maximal generalized -palindromes in each of the considered metrics (see the classic result from [15] for the Hamming distance and Lemma 2 for the edit distance) to obtain the following result.
Theorem 2**.**
The Generalized Maximal -Palindromic Decomposition with Gaps problem under the Hamming distance or the edit distance can be solved in time and space.
Example 4**.**
Consider the following string111See http://www.cesshiv1.org/disview.php?accession=AB220944 of length 92:
GGACTCGGCTTGCTGAGGTGCACACAGCAAGAGGCGAGAGCGGCGACTGGTGAGTACGCCAAATTTTGACTAGCGGAGGCTAGAAGGAGAGA
We have used our implementation of the algorithm from Theorem 2 to compute the decomposition of the string into maximal complemented 3-palindromes of length at least 14 under the edit distance with at most 4 gaps (, , ) with the minimal total gap length:
[GGACTCG] GCTTGCTGAGGTGCACACAGCAAGA [GGCGAGAGC] GGCGACTGGTGAGTACGCC [AAATTTTG]
ACTAGCGGAGGCTAGA [AGGAGAGA]
The gaps are given in square brackets. Edit operations are underlined, with deletes additionally given in italics. The gaps have total length 32.
In comparison, the optimal decomposition of this string under the Hamming distance with the same parameters (, , ) uses four gaps of total length 46.
6 Conclusions
We have presented two algorithms for finding palindromic decompositions: one allowing gaps and the other allowing both gaps in the decomposition and errors in palindromes. The first algorithm shows that (somewhat surprisingly) Fici et al.’s algorithm [9] for finding an exact palindromic factorization can be extended to handle gaps, a constraint on the palindromes length, and complements in palindromes as well. In the second algorithm we decompose a string into maximal palindromes with errors; the most involved part here was computing all such maximal palindromes under the edit distance.
In the problems that were defined in the beginning, the objective was to minimize the total length of gaps, allowing a certain number of gaps. However, the approaches that were presented in this paper can be used to solve different variants of the problems, like minimizing only the total number of gaps or maximizing the total length of palindromes, regardless of the number of gaps.
An open question is to efficiently compute decompositions into palindromes that may contain errors and are not necessarily maximal. This problem seems to be hard, as -palindromes do not have such a strong combinatorial structure as palindromes without errors.
Acknowledgments
We would like to warmly thank G. Fici, T. Gagie, J. Kärkkäinen, and D. Kempa for providing us Figures 4, 5, and 6 (that we adapted and present in Appendix A) that they first presented in [9].
Appendix A Generalized palindromic factorization
In this section we show that the approach of Fici et al. [9] works for generalized palindromes for any involution . The following auxiliary lemma extends the combinatorial properties of standard palindromes used in [9] (see Lemmas 1-3 therein) to generalized palindromes. Recall that a string is called a border of a string if it is both a prefix and a suffix of . A number is called a period of if for all . It is well known that has a period iff it has a border of length ; see [5, 6].
Lemma 3**.**
- (a)
Let be a suffix of a generalized palindrome . Then is a border of iff is a generalized palindrome. 2. (b)
Let be a string with a border such that . Then is a generalized palindrome iff is a generalized palindrome. 3. (c)
Let be a proper suffix of a generalized palindrome . Then is a period of iff is a generalized palindrome. In particular, is the smallest period of iff is the longest generalized palindromic proper suffix of .
Proof.
(a) Let be the prefix of of length . As is a generalized palindrome, . If is a border of , then , so is a generalized palindrome. If is a generalized palindrome, then , so is a border of .
(b) From (a), if is a generalized palindrome and is its border, then is a generalized palindrome. If is a generalized palindrome, has a border . This border covers the whole string and is the same as the border of , so and indeed is a generalized palindrome.
(c) This is a consequence of part (a) and the relation between borders and periods of a string. ∎
=The crucial combinatorial property of standard palindromes used in Step 1 of the algorithm in Section 3 is that the sequence of consecutive differences in is non-increasing and contains at most distinct values. We show that the same observation holds for generalized palindromes; this follows from the next lemma, parts (1) and (2). The proof of Lemma 4 follows exactly the lines of the proof of the corresponding Lemma 4 in [9]; Figures 4 and 5 (thanks to the courtesy of the authors of [9]) are included for illustration.
Lemma 4**.**
Let be a generalized palindrome, the longest generalized palindromic proper suffix of , and the longest generalized palindromic proper suffix of . Let and be strings such that and . Then:
- (1)
; 2. (2)
if then ; 3. (3)
if then .
Proof.
See Figure 4 for an illustration.
(1) By Lemma 3(c), is the smallest period of , and is the smallest period of . Since is a factor of , either or is a period of too, and thus it cannot be smaller than .
(2) By Lemma 3(a), is a border of and thus is a prefix of . Let be a string such that . Then is a border of and (see Figure 5). Since we assume , we must have . Suppose to the contrary that . Then , and by Lemma 3(b), is a generalized palindrome. But this contradicts being the longest generalized palindromic proper suffix of .
(3) In the proof of (2) we saw that is a prefix of , and so is by definition. Thus if . ∎
We have thus shown that, also in case of generalized palindromes, the set can be compactly represented by a set , as described in Section 3. To complete Step 1 of the algorithm, we need to show that can be computed from in time. For this, just as in [9], we show that each triple will be either eliminated or replaced by in . The proof exploits part (3) of Lemma 4.
Lemma 5**.**
Let and be two consecutive elements of . Then iff .
Proof.
By definition, , and the predecessor of in is . The strings , , and form the situation of Lemma 4(3). Hence, . Thus, iff iff . ∎
After this transformation, one might need to update pairs of adjacent triples in because the gaps between them might have changed. This simple process is explained in detail in [9] and takes only additional time.
As for Step 2 of the algorithm, it suffices to show that the following combinatorial observation holds for generalized palindromes. Again we follow the lines of the proof from [9]; Figure 6 (thanks to the courtesy of the authors of [9]) is included for illustration.
Lemma 6**.**
If and , then .
Proof.
By definition, is equivalent to saying that , and we need to show that . We will show first that and then that .
Since and are generalized palindromes and is the longest proper border of (by Lemma 3(a)), . Thus for all , iff (see Figure 6a). In particular, the consecutive differences in both cases are the same and for all , iff . Thus .
We still need to show that , which is true if and only if . Suppose to the contrary that is a generalized palindrome and let . Then . Since and are generalized palindromes too, we have that and . Finally, since is a generalized palindrome, is a generalized palindrome (see Figure 6b). This implies that and thus , which is a contradiction. ∎
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1[1] Michał Adamczyk, Mai Alzamel, Panagiotis Charalampopoulos, Costas S. Iliopoulos, and Jakub Radoszewski. Palindromic decompositions with gaps and errors. In Computer Science - Theory and Applications - 12th International Computer Science Symposium in Russia, CSR 2017, Proceedings (accepted for publication) , 2017.
- 2[2] Ali Alatabbi, Costas S Iliopoulos, and Mohammad Sohel Rahman. Maximal palindromic factorization. In Stringology , pages 70–77, 2013.
- 3[3] Alberto Apostolico, Dany Breslauer, and Zvi Galil. Parallel detection of all palindromes in a string. Theor. Comput. Sci. , 141(1):163–173, 1995.
- 4[4] Dany Breslauer and Zvi Galil. Finding all periods and initial palindromes of a string in parallel. Algorithmica , 14(4):355–366, 1995.
- 5[5] Maxime Crochemore, Christophe Hancart, and Thierry Lecroq. Algorithms on Strings . Cambridge University Press, 2007.
- 6[6] Maxime Crochemore and Wojciech Rytter. Jewels of Stringology . World Scientific, 2003.
- 7[7] Xavier Droubay. Palindromes in the Fibonacci word. Inf. Process. Lett. , 55(4):217–221, 1995.
- 8[8] Xavier Droubay and Giuseppe Pirillo. Palindromes and Sturmian words. Theor. Comput. Sci. , 223(1-2):73–85, 1999.
