Control of Transposon-mediated Activation of the glpFK Operon of Escherichia coli by two DNA binding Proteins
Zhongge Zhang, Milton H. Saier
TL;DR
The study explores how two DNA binding proteins control transposon activation of a glycerol utilization gene in E. coli.
Contribution
The paper reveals how cAMP-Crp and GlpR inhibit IS5 transposon insertion into the glpFK operon regulatory region.
Findings
cAMP-Crp and GlpR both inhibit IS5 insertion into the glpFK upstream region.
Maximal IS5 insertion occurs in the presence of glycerol and a non-metabolizable sugar analogue.
IS5 insertional mutants outcompete wild type cells under these conditions.
Abstract
Escherichia coli cells deleted for the cyclic AMP (cAMP) receptor protein (Crp) gene (Δcrp) cannot utilize glycerol because cAMP-Crp is a required positive activator of glycerol utilization operon glpFK. We have previously shown that a transposon, Insertion Sequence 5 (IS5), can reversibly insert into the upstream regulatory region of the operon so as to activate glpFK and enable glycerol utilization. GlpR, which represses glpFK transcription, binds to the glpFK upstream region near the site of IS5 insertion, and prevents insertion. We here show that the cAMP-Crp complex, which also binds to the glpFK upstream regulatory region, also inhibits IS5 hopping into the activating site. This finding allowed us to identify conditions under which wild type cells can acquire glpFK-activating IS5 insertions. Maximal rates of IS5 insertion into the activating site require the presence of glycerol…
Genes, proteins, chemicals, diseases, species, mutations and cell lines named across the full text — each resolved to its canonical identifier and authoritative record.
Click any figure to enlarge with its caption.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Peer Reviews
No public reviews on file for this paper yet. If you reviewed it on a platform where reviews are public (OpenReview, ICLR, NeurIPS, ICML), you can paste yours below so the community can read it here.
Videos
No videos yet. Explain this paper in a talk, walkthrough, or lecture? Add one.
Taxonomy
TopicsBacterial Genetics and Biotechnology · CRISPR and Genetic Engineering · RNA and protein synthesis mechanisms
Introduction
Wild type E. coli cells can grow on glycerol as a sole carbon source, but cells lacking the cAMP receptor protein (Crp) cannot (Lin, 1976, Won et al., 2009, Fic et al., 2009). In a previous communication (Zhang and Saier, 2009a), we showed that a Δcrp strain could mutate to rapid glycerol utilization due to insertion of the small transposon, Insertion Sequence 5 (IS5) (Sousa et al., 2013). To cause activation, IS5 hops into a single site, in a single orientation, upstream of the glpFK operon promoter. The presence of IS5 at this site activates the glpFK promoter so that it becomes stronger than that in wild type cells (Zhang and Saier, 2009a). Interestingly, a gene-activating IS5 insertion is capable of undergoing subsequent precise excision (Zhang et al., 2010), showing that IS5-mediated operon activation can be a fully reversible process. The glpFK-activating insertional event occurred at high frequency in the presence of glycerol, but not in the presence of glucose or other carbon sources. Glycerol increased insertion of IS5 at this specific site, but not in other operons (Zhang and Saier, 2009a, Zhang and Saier, 2011). Glycerol-promoted IS5 insertion into the glpFK-activating site proved to be regulated by binding of the glycerol repressor, GlpR, when bound to the four adjacent glpFK operators, O1, O2, O3 and O4 in the glpFK control region. However, it became clear that the effect of GlpR-binding on IS5 insertion was not mediated by increased expression of glpFK, or by increased growth, since binding to O1 primarily controlled IS5 insertion without a significant impact on transcription, while binding to O4 primarily controlled transcription (Zhang and Saier, 2009a). Thus, the negative control of IS5 insertion into the upstream activating site is a newly recognized function of GlpR that is distinct from the previously recognized function of repressing glpFK transcription (Zhang and Saier, 2011).
In a previous study, Hall has summarized situations where transposon insertion to activate cryptic operons is elevated under conditions of starvation (Hall, 1999). More recently, Wang and Wood (Wang and Wood, 2011) described another example of IS5 insertion that occurs at a higher frequency when beneficial, giving rise to activation of the E. coli flagellar master switch operon, flhDC. Insertional activation of flhDC substantially enhances bacterial swarming in semisolid agar media, and the swarming phenotype is beneficial under adverse conditions such as nutrient depletion. Under conditions where swarming is not permitted (liquid or on solid agar media), insertional activation of the flhDC operon is not beneficial, and the frequency of insertion is greatly reduced. Thus, insertion of IS5 upstream of the flhDC operon is another example of a mutation whose frequency is elevated under conditions where the mutation is advantageous. We have now confirmed the observations of Wang and Wood, 2011, in our laboratory (Zhang et al., 2013).
Since de novo IS5 insertion at a single site in the glpFK operon in Δcrp cells is promoted by starvation in the presence of glycerol, and the insertion event relieves the starvation by enabling glycerol utilization, the question arises whether this constitutes an evolved mechanism. However, in wild type (crp^+^) cells, under the tested laboratory conditions, no such IS5 insertion mutants were obtained (Zhang and Saier, 2009a, Herring et al., 2006, Cheng et al., 2014). Our earlier studies had been conducted in a Δcrp deletion strain which grows poorly and consequently is not present under normal environmental conditions.
In this communication, we first report that in ΔcyaA crp^+^ cells, IS5-mediated glpFK activation occurs in a manner strictly analogous to that observed in Δcrp mutant cells. The cyaA gene codes for the cyclic AMP biosynthetic enzyme, adenylate cyclase, Cya (Gancedo, 2013). We further show that addition of cAMP to the growth medium, known to increase the cytoplasmic cAMP concentration (Saier et al., 1982), greatly suppressed IS5 insertion specifically to this site. This effect occurred independently of GlpR, but it depended exclusively on Crp and the two adjacent Crp binding sites (CRPI and CRPII) that overlap the two GlpR binding sites O2 and O3, in the glpFK control region (Zhang and Saier, 2009a, Weissenborn et al., 1992). It thus became clear that the conditions that predispose the glpFK operon to activation by IS5 in wild type cells were (i) the presence of glycerol, and (ii) the presence of an environmental agent that could lower cytoplasmic cAMP levels.
Non-metabolizable glucose analogues and other sugar substrates of the phosphoenolpyruvate (PEP):sugar phosphotransferase system (PTS) are among the compounds known to lower cellular cAMP concentrations by inhibiting adenylate cyclase (Feucht and Saier, 1980). These include 2-deoxy-D-glucose (2DG) and methyl-α-D-glucoside (αMG) (Saier et al., 1982). Here we show that incubation of wild type E. coli cells in glycerol media together with 2DG or αMG promotes glpFK-activating IS5 insertional events. To determine whether under these conditions IS5 mutants can accumulate and take over the population, we carried out long-term growth experiments. Our results are consistent with a scenario in which IS5 insertional activation of glpFK evolved in wild type cells as a mechanism to overcome adverse environmental conditions.
Materials and Methods
Bacterial Strains and Growth Conditions
Strains and DNA oligonucleotides used in this study are described in Supplementary Tables 1 and 2, respectively. The cyaA deletion mutant was generated from the parental strain (E. coli K-12 strain BW25113) using the method of Datsenko and Wanner (Datsenko and Wanner, 2000b). Briefly, a kanamycin resistance gene (km), flanked by the FLP recognition site (FRT) was amplified from the template plasmid pKD4 using mutation oligos cyaA1-P1 and cyaA2-P2 (Supplementary Table 2), each of which is composed of a ~20 bp region at the 3’ end that is complementary to the FRT-flanking km sequence, and a ~50 bp region at the 5’ end that is homologous to cyaA. The PCR products were gel purified, treated with DpnI, and then electroporated into BW25113 cells expressing the lamada-Red proteins encoded by plasmid pKD46. The pKD46 plasmid, which carries a temperature-sensitive origin of replication, was removed by growing the mutant cells overnight at 40 ^o^C. The Km^r^ mutants were verified for the replacement of the target gene by the FRT-flanking km gene by PCR. The km gene was subsequently eliminated (leaving an 85-bp FRT sequence) using plasmid pCP20 that bears the FLP recombinase. The cyaA glpR double mutant was constructed by transferring a km insertional mutation of the cyaA gene into the glpR deletion mutant background (Zhang and Saier, 2009a) using P1 transduction.
To fuse the chloramphenicol-resistance gene (cat) with the glpFK operon, downstream of glpK in the chromosome, the plasmid pKD13-cat made previously (Zhang and Saier, 2009a), was used. In this plasmid, the cat gene is located upstream of a FRT-flanking km gene (Datsenko and Wanner, 2000b). The cat structural gene with its own ribosome binding site (RBS), together with its downstream km gene, was amplified from pKD13-cat using primers glpFKcat1-P1 and glpFKcat2-P2 (Supplementary Table 2). The PCR products were electroporated into wild type, ΔcyaA and ΔcyaA ΔglpR cells to replace the 85-bp downstream region between the 8^th^ nucleotide and the 94^th^ nucleotide relative to the glpK stop codon in the chromosome. After electroporation, the cells were selected on LB + Km agar plates. The Km^r^ colonies were verified for the substitution of the 85 bp glpK/glpA intergenic region by PCR and subsequent DNA sequencing. In the resultant strains (named BW_Cat, ΔcyaA_Cat and ΔcyaA ΔglpR_Cat, respectively), glpF, glpK and cat form a single operon with its expression solely under the control of the glpFK promoter (PglpFK).
Strains were cultured in LB, NB or minimal M9 media with various carbon sources at 37ºC or 30ºC. When appropriate, kanamycin (Km; 25 μg/ml), ampicillin (Ap; 100 μg/ml), or chloramphenicol (Cm; 16-60 μg/ml) was added to the media.
Mutations of Chromosomal Crp Operators
To modify the chromosomal Crp binding sites in the control region of the glpFK operon, the previously made plasmid pKD13-PglpFK (Zhang and Saier, 2009a), was used. In this plasmid, PglpFK and the FRT-flanking km gene were oriented in opposite directions. Using the quick-change site-directed mutagenesis kit (Agilent) and oligos PglpFKCrpI&II-F and PglpFKCrpI&II-R (Supplementary Table 2), both Crp operators (OCrpI and OCrpII) in the glpFK control region, contained within pKD13-PglpFK, were mutated by changing tatgacgaggcacacacattttaagt (-69 to –44 relative to +1 of PglpFK) to gacagcgaggcatctgcattttaatc (substitutions are underlined). The substitutions were confirmed by sequencing. Using the resultant plasmid, pKD13-PglpFK_O_CrpI&I I_, as template, the region containing the km gene and PglpFK_O_CrpI&II_ was PCR amplified using the primers PglpFKCrpI&II-P1 and PglpFKCrpI&II-P2 (Supplementary Table 2). The PCR products were integrated into the ΔcyaA mutant chromosome to replace the wild type PglpFK. The nucleotide substitutions in both OCrpI and OCrpII operators were confirmed by sequencing. The km gene was removed, and the resultant strains were named ΔcyaA O_CrpI&II_ (Supplementary Table 1).
Glp+ Mutation Assay Using a ΔcyaA Mutant Strain
Using the ΔcyaA deletion mutant, mutation to Glp^+^ was first measured on minimal M9 + 0.2% glycerol agar plates as described previously (Zhang and Saier, 2009a). Briefly, cells from an overnight LB culture were washed and inoculated onto plates (~10^8^ cells/plate). The plates were then incubated in a 30 ºC incubator and were examined daily for the appearance of Glp^+^ colonies with each colony representing a Glp^+^ mutation. On these glycerol minimal agar plates, any colonies appearing by day 2 were considered to be from Glp^+^ cells initially present when applied to the plates. They were therefore subtracted from the subsequent measurements. The total numbers of Glp^-^ cells were determined as described by Cairns and Foster (Cairns and Foster, 1991). The Glp^+^ mutations were determined by counting the Glp^+^ colonies that appeared on the original agar plates. The frequencies of Glp^+^ mutations on glycerol M9 plates were determined by dividing the numbers of Glp^+^ colonies by the total Glp^-^ populations. To determine if any of the Glp^+^ colonies arose from Glp^+^ cells initially plated, the ΔcyaA cells, together with small numbers of ΔcyaA Glp^+^ cells, were plated onto the same M9 + 0.2% glycerol plates. The plates were incubated and examined as above.
To determine the effect of cAMP on the frequency of IS5 insertion into the glpFK activating site, strain ΔcyaA_Cat (in which glpF, glpK and cat are fused in a single operon, see Supplementary Table 1) was used. This strain is sensitive to Cm at 8 μg/ml while the same strain with the IS5 insertion (ΔcyaA Glp^+^_Cat) is resistant to Cm at 16 μg/ml. Preliminary experiments showed that all ΔcyaA_Cat cells resistant to Cm at 16 μg/ml were due to IS5 insertion in front of PglpFK. To determine the effect of cAMP on IS5 insertion, an 8-h old culture from a single ΔcyaA_Cat colony was diluted 1000 x into 5 ml LB ± cAMP (0 to 5 mM) contained in 30 ml glass tubes (2.5 cm x 20 cm). The tubes were shaken at 250 rpm in a 30 ^o^C water bath shaker. After 15 h, the cells were washed 1x (to remove residual cAMP) with carbon source-free M9 salts, serially diluted, and applied onto LB + glucose agar plates and LB + glucose + Cm agar plates. The plates were incubated at 37 ^o^C for 15 to 18 h. Total populations and Glp^+^ populations were determined based on numbers of colonies on LB + glucose plates and on LB + glucose + Cm plates, respectively. The frequencies of Glp^+^ mutation were determined by the ratios of Cm^r^ populations to total populations.
To determine if cAMP affects IS5 insertion into other chromosomal sites, we chose to analyze mutants resistant to Furazolidone (FZD) using ΔcyaA_Cat cells. First, step I mutants were isolated by spreading the cells onto nutrient broth (NB) agar plates with a low concentration (1 μg/ml) of FZD. The cells of a step I mutant were then applied onto the agar plates with higher concentrations (5-7.5 μg/ml) of FZD. The plates were incubated at 30 ^o^C for 36 h or above, and colonies obtained were examined for the presence of IS elements in the nfsB gene by PCR using oligos nfsB-ver-F and nfsB-ver-R (Supplementary Table 2). Among those mutants carrying IS elements, IS5 insertional mutants were determined by two rounds of PCR, using oligos IS5-ver-F / nfsB-ver-R and nfsB-ver-F / IS5-ver-F, respectively. The ratio of IS5 mutants was calculated by dividing total IS mutant numbers by IS5 mutant numbers.
To establish the effects of mutations in the Crp operators in the glpFK control region on the appearance of Glp^+^ IS5 insertional mutations, the ΔcyaA O_CrpI&I I__Cat cells with mutations in operators, OCrpI and OCrpII, were examined for the appearance of Glp^+^ mutations in LB media with or without cAMP as described above. To determine the effect of loss of glpR on Glp^+^ mutation frequency, the ΔcyaA ΔglpR double mutant was examined for Glp^+^ mutations in liquid LB ± cAMP (0.1 mM) as compared to the single ΔcyaA mutant as described above.
To determine the effect of glpR overexpression on the Glp^+^ mutations, the glpR structural gene was amplified from the wild type genomic DNA using primers glpR-KpnI and glpR-BamHI (Supplementary Table 2). The PCR products were digested with KpnI and BamHI, gel purified, and then ligated to the same sites of pZA31 (Lutz and Bujard, 1997), yielding pZA31-glpR, in which glpR is driven by a synthetic tet promoter (Ptet). The same plasmid carrying a random fragment (RF), pZA31-RF, served as a control (Levine et al., 2007a). To repress Ptet activity, the constitutively expressed tetR cassette, located at the attB site, was transferred to ΔcyaA_Cat carrying pZA31-glpR from BW-RI (Levine et al., 2007b) by P1 transduction. Therefore, the expression of glpR could be induced by a tetracycline analog, chlorotetracycline (cTc). The resultant strain containing the tetR source and pZA31-glpR was tested for Glp^+^ mutations in LB ± 0.1mM cAMP as described above. To induce expression of glpR in pZA31-glpR, cTc (250 ng/ml) was added to the medium.
To further demonstrate cAMP inhibitory effects on the appearance of IS5 insertional mutants, and the competitive abilities of the mutants under low cAMP conditions, we performed a long-term experiment by transferring cultures to new media at various intervals. To do this, an LB culture (10 μl) of ΔcyaA_Cat was used to inoculate M9 + glycerol ± cAMP (0 to 1 mM) media. Before the first transfer, every 12 h or so, the cultures were serially diluted onto LB + glucose plates for total population determination and onto LB + glucose + Cm plates for Glp^+^ (IS5 insertion) mutant population determination. After 2 or 2.5 days, the cultures were 1000x diluted into new tubes with the same media. Then at one-day intervals, the cultures were 1000x diluted into fresh media. For each transfer, the total cells and the Glp^+^ mutant populations were determined.
IS5 Insertional Mutation Assay Using A Wild Type Background
2-deoxyglucose (2DG) is a non-metabolizable glucose analog that reduces the level of cytoplasmic cAMP level when adding to the media (Saier, 1989). Preliminary experiments showed that E. coli cells are sensitive to this compound at 0.1%. To determine if IS5 insertion upstream of PglpFK occurred in a wild type background, BW_Cat cells (Supplementary Table 1) were tested for IS^5^ insertion on M9 + glycerol (0.2%) + 2DG (0.13%) ± Cm (60 μg/ml) agar plates. The plates were incubated at 30 ^o^C, and the colonies were examined for the presence of IS^5^ in the upstream glpFK operon control region by PCR followed by gel electrophoresis.
Long Term Evolutionary Experiments
At least two types of mutations arose when BW_Cat cells were incubated on M9 + glycerol + 2DG ± Cm agar plates, the IS^5^ insertional mutation and a non-IS^5^ mutation of unknown nature. To determine if the IS^5^ insertional mutants are more competitive than the non-IS^5^ insertional mutants, 10 μl of a fresh LB culture of BW_CAT was used to inoculate 5 ml of M9 + glycerol (0.2%) + 2DG (0.13%) ± Cm (60 μg/ml) in 30 ml glass tubes. The tubes were incubated with shaking (250 rpm) in a 30 ^o^C water bath shaker. After 2.5 days of incubation, the cultures (i.e., mutant cells resistant to 2DG and Cm) were 1000x diluted into new tubes with the same media. On every other day, the mutants were 1000x diluted into new tubes. For each transfer, the mutant cultures were serially diluted using carbon source-free M9 salts, and the 10^5^fold and 10^6^-fold dilutions were applied onto M9 + glycerol + 2DG ± Cm agar plates before incubation at 37 ^o^C. After 2 days, 100 colonies from each transfer were subjected to PCR and subsequent gel electrophoresis analyses to determine the percentages of IS^5^ insertion mutants to the total mutants. Note that the parental cells do not grow under these conditions.
Chromosomal lacZ Fusions and β-Galactosidase Assays
Using pKD13-PglpFK (Zhang and Saier, 2009a) and pKD13-PglpFK*O_CrpI&II* (Supplementary Table 1) as templates, PglpFK (-204 to +66 relative to the transcriptional start site) and PglpFK*O_CrpI&I I* plus their upstream FRT-flanked km^r^ gene were amplified using oligos PglpFKz-P1 and PglpFKz-P2 (Supplementary Table 2). Using the method of Datsenko and Wanner (Datsenko and Wanner, 2000a), the promoters plus the upstream km^r^ gene (km^r^:PglpFK or km^r^:PglpFK*O_CrpI&II) were integrated into the chromosome to replace the lacI gene and the native lac promoter (including the 5’ UTR of lacZ) of MG1655 deleted for lacY (Klumpp et al., 2009). This chromosomal replacement was confirmed by PCR and subsequent DNA sequencing analysis. The resultant strains are deleted for both lacI and lacY, but they carry the lacZ gene that is expressed under the control of PglpFK* or PglpFK*O_CrpI&II. Both constructs were transferred into ΔcyaA* and ΔcyaA ΔglpR strains by P1 transduction, yielding ΔcyaAPglpFK-lacZ, ΔcyaAPglpFK*O_Crp-lacZ, ΔcyaAΔglpR* _PglpFK-lacZ, and ΔcyaAΔglpR PglpFKO_Crp__lacZ (Supplementary Table 1).
For β-galactosidase assays, strains were cultured in liquid LB media ± 1 mM cAMP at 30 ^o^C. When cultures entered the exponential phase, samples were collected for measurement of β-galactosidase activities as described by Miller (Miller, 1972).
Results
IS5 insertional activation of the glpFK operon occurs in ΔcyaA mutant cells
We previously demonstrated that Δcrp mutant cells of E. coli could regain the ability to utilize glycerol by IS^5^-mediated insertional mutations that specifically occurred at a single site, upstream of the glpFK promoter, preferentially in the presence of glycerol (Zhang and Saier, 2009a). In this study, we first used ΔcyaA mutant cells lacking the cAMP biosynthetic enzyme, adenylate cyclase, Cya. Like the Δcrp mutant cells, the ΔcyaA mutant cells cannot utilize glycerol as the sole carbon source for growth. However, after a prolonged incubation on M9 + glycerol agar plates, Glp^+^ mutants could be observed (Figure 1). These mutants were IS^5^ insertional mutants carrying IS^5^ in the same position and orientation upstream of the glpFK promoter as those isolated previously from Δcrp cells. The time course (Figure 1) for their appearance and the properties of these double mutants were indistinguishable from those isolated previously (Zhang and Saier, 2009a). Among at least 100 independent Glp^+^ mutants analyzed, no other types of mutants arose under the conditions used. There was an approximately two-day delay before mutant colonies appeared, and these clearly arose during incubation on the plates, since when small numbers (e.g. 11 and 23) of identical Δcya Glp^+^ insertional mutants were added to the ΔcyaA cells prior to plating, they gave rise to colonies within a shorter time period (Figure 1).
Glp+ mutations in ΔcyaA cells on M9 + glycerol agar plates. AcyaA cells (~108) from a fresh LB culture were spread on M9 + glycerol (0.2%) agar plates. The plates were incubated at 30°C and examined for the appearance of Glp+ colonies (each colony represents an IS5 insertional mutation) at 24-h intervals. The mutation frequencies were determined as in Zhang and Saier (Zhang and Saier, 2009a). ♦ = no Glp+ cells added before initially plating; ■ and ▴ = 11 and 23 Glp+ cells were included before plating.
IS5 activation of the glpFK operon in ΔcyaA cells is suppressed by exogenous cAMP
Exogenous cAMP can enter cells to increase the cytoplasmic concentration of this nucleotide (Saier et al., 1982). Figure 2A shows the effect of increasing concentrations of external cAMP on the glpFK-specific IS5 insertional frequency in ΔcyaA glpFK_cat cells (see Materials and Methods and Supplementary Table 1). At a concentration of 10 µM, exogenous cAMP had only a slight inhibitory effect on IS5 insertion, but at 100 µM, cAMP inhibited over 90%, whereas at 1 mM, cAMP essentially abolished IS5 insertion (Figure 2A).
Effects of cAMP on (A) IS5 insertion upstream of the glpFK regulatory region in AcyaA cells, and (B) in the nfsB gene as a control. In A, a fresh LB culture from a single ΔcyaA-Cat (see Supplementary Table 1) colony was diluted 1000 x into 5 ml of LB ± cAMP (0 to 5 mM) in 30 ml glass tubes (2.5 cm x 20 cm). The tubes were shaken at 250 rpm in a 30 oC water bath shaker. After ~15 h, the cells were washed 1x (to remove residual cAMP) with carbon source-free M9 salts, serially diluted, and applied onto LB + glucose agar plates (for total population determination) and LB + glucose + Cm (16 ug/ml) agar plates (for IS5 insertional mutant population determination). In B, the cells (~2x 10) of a step I furazolidone (FZD) resistant (FZDr) mutant strain isolated from a AcyaA-Cat strain, were applied to nutrient broth (NB) agar plates, with furazolidone (5 or 7.5 jig/ml) ± cAMP (1mM). The plates were incubated at 30 oC for 36 h before being examined for the appearance of FZDr mutants. Among these FZDr mutants, IS5 or other IS insertional mutants in the nfsB gene were determined by PCR (see Materials and Methods). In all cases, the proportion of IS5 mutants (~60%) was the same.
To determine whether the decrease in IS5 insertion frequency due to the presence of cAMP was specific to the glpFK promoter, we analyzed IS5 insertion at the nfsB gene in ΔcyaA cells. Mutational inactivation of nfsB confers resistance to furazolidone (FZD) (Whiteway et al., 1998), and a significant fraction of inactivating mutations are due to IS5 insertion (see Materials and Methods). As shown in Figure 2 B, cAMP did not influence the frequency of total insertional events (grey bars) or of IS^5^ insertional events (black bars) among FZD-resistant mutants within experimental error.
The effect of cAMP on IS5 insertion frequency requires Crp-binding sites in the glpFK promoter
To determine whether the inhibition of IS5 insertion upstream of the glpFK promoter by cAMP is due to the binding of the cAMP-Crp complex to the two adjacent Crp binding sites (O_CrpI_ and O_CrpII_), present in the glpFK promoter, we analyzed the consequences of point mutations within these binding sites. These mutations essentially abolished the inhibitory effect of Crp on IS5 insertion (Figure 3A). Although these Crp operator mutations eliminated binding of the cAMP-Crp complex, they did not change the glpFK promoter strength in the cyaA deletion background, and the promoter activity was still under the control of GlpR (Figure 3B). Thus, it can be concluded that inhibition by cAMP-Crp of IS5 insertion into the glpFK activating site is due to the binding of the cAMP-Crp complex solely to these two operators present in the glpFK promoter region.
Effect of Crp binding site mutations on IS5 insertion upstream of the glpFK promoter region (A) and the promoter activity in AcyaA cells grown in LB medium ± cAMP (B). The concentrations of cAMP are indicated below the x-axis. Ocrp= the mutated Crp binding sites (OcrpI and Oc rpII) in the upstream regulatory region of the glpFK operon to prevent Crp binding. In b, the activities of the glpFK promoter (PglpFK) and the same promoter (PglpFK_Ocrp) mutated in OcrpI and OcrpII were measured using the LacZ reporter in both ΔcyaA cells and ΔcyaA ΔglpR cells. See Supplementary Table 1 for the detailed strain information.
Crp and GlpR independently affect IS5 insertion upstream of the glpFK promoter
To determine if GlpR plays a role in the inhibitory effect of Crp on IS5 insertion, we deleted the glpR gene in the ΔcyaA background, yielding a ΔcyaA ΔglpR double mutant (Supplementary Table 1). Higher IS5 insertional frequencies were observed in the ΔcyaA ΔglpR cells than in the ΔcyaA cells when grown in LB (no glycerol added) (Figure 4A). However, in the absence of GlpR, cAMP still exerted its inhibiting effect, presumably by binding to Crp, which then bound to its two glpFK operon binding sites, O_CrpI_ and O_CrpII_ (compare column 2 and column 4 in Figure 4A). Comparable inhibition was observed regardless of the presence of glycerol or GlpR. It was therefore concluded that regulation of IS5 insertion by the cAMP-Crp complex occurs independently of glycerol and GlpR.
Effects of glpR deletion (A) and glpR overexpression (B) on IS5 insertion in the control region of the glpFK operon in ΔcyaA cells grown in LB ± cAMP. In A, the exogenous cAMP concentration was either 0 (left) or 0.1 mM (right). In B, vector: no glpR expression (control); GlpR indicates glpR expression; cTc = chloro-tetracycline (an inducer of the tet promoter) at the concentrations of 0 (left) or 250 ng/ml (right). glpR expression is under the control of the cTc induced promoter, Ptet, in an expression vector. The ΔcyaA cells that constitutively produce TetR (repressing Ptet) were used in these experiments. Note scale difference for Figure 4A and 4B.
When GlpR was over-produced in the absence of cAMP, GlpR still exerted its strong inhibitory effect (Figure 4B). In the left panel, the glpR gene was expressed at an extremely low level, and GlpR exerted only a minimal effect because chlorotetracycline (cTc), the inducer, was not present. When the cTc concentration was high (250 ng/ml), glpR was expressed at a high level, and the rate of IS5 insertion into the glpFK upstream site was greatly reduced (see right panel of Figure 4b). The same experiments were conducted in the presence of cAMP (0.1mM). The IS5 insertion frequency decreased, while overexpression of GlpR further inhibited IS5 insertion (data not shown). These results suggest that GlpR and the cAMP-Crp complex exert their effects on IS5 insertion independently of each other. These experiments also provide evidence that that GlpR and the cAMP-Crp complex can bind to the glpFK control region simultaneously.
IS5 insertional activation of the glpFK operon occurs in a wild type background in the presence of 2-deoxyglucose
Since a reduction in cAMP promotes IS^5^ insertion in the glpFK activating site, we sought to determine whether environmental conditions that could lead to a reduction in cAMP concentrations could elevate IS5 insertion into the glpFK promoter. Non-metabolizable glucose analogues, such as 2-deoxyglucose (2DG) and α-methylglucoside (αMG), (He and Liu, 2002, Holst and Williamson, 2004, Kumar et al., 2013, Moller, 2010, Tantanarat et al., 2012, Saier and Ballou, 1968, Xi et al., 2014) are known to lower cytoplasmic cAMP levels by inhibiting adenylate cyclase activity (Gabor et al., 2011, Gershanovich, 2003, Saier et al., 1996, Vastermark and Saier, 2014). These analogues also strongly inhibit growth on glycerol, at least in part due to inhibition of both cytoplasmic cAMP production by adenylate cyclase, and of cytoplasmic glycerol-3-phosphate (substrate/inducer) production by glycerol kinase (Kuroda et al., 2001, Peterkofsky et al., 2001, Schlegel et al., 2002, Saier and Reizer, 1994). We therefore asked if we could isolate IS5 insertional mutants in a wild-type background on minimal M9 agar plates containing glycerol, inhibitory concentrations of 2DG or αMG and chloramphenicol. The results for αMG proved to be same as for 2DG, and consequently, only those obtained with 2DG are presented here.
In these experiments, a glpFK-cat (chloramphenicol acetyl transferase) fusion was used to measure IS5 insertion (see Supplementary Table 1 and Materials and Methods). Regardless of the inhibitory glucose analogue used, 2DG/αMG, resistant (2DG^r^/ αMG^r^) mutants (which were also Glp^+^) could be isolated in a wild type E. coli genetic background (Jones-Mortimer and Kornberg, 1980, Kornberg et al., 2000, Rephaeli and Saier, 1980). As shown in Figure 5, PCR analyses of colonies that appeared after a five-day incubation at 30°C revealed two types of Glp^+^ mutants: (i) a majority that did not have an insertion in the glpFK promoter (dubbed “non-IS5 mutants” here), and (ii) a minority (<10%; “IS^5^ mutants”) that had IS^5^ inserted into the glpFK promoter-activating site.
IS5 insertion upstream of the glpFK control region in wild type cells. Wild type cells carrying the glpFK-cat (chloroamphenicol acetyl transferase) fusion (See Methods section) were plated onto M9 + glycerol (0.2%) + 2DG (0.12%) + chloramphenicol (Cm) (55 μg/ml) agar plates. The plates were incubated at 30 oC. After 5 days of incubation, colonies were examined for the presence of IS5 upstream of the glpFK control region by PCR. In both the upper and the lower panels, a single IS5 insertion was obtained. A DNA marker showing four bands with known sizes (4 kb, 2 kb, 1 kb and 0.5 kb from above) is indicated in each panel.
Sequencing revealed that the non-IS^5^ insertion mutants did not have genetic alterations in the glpFK operon, or in the fruR gene [which appears to regulate crp gene expression (Zhang et al., 2014)]. Unlike IS^5^ insertional mutants, the non-IS^5^ mutants showed a pleiotropic phenotype in addition to their increased growth in a glycerol + 2DG medium, such as poor utilization of sorbitol (D-glucitol) and succinate (Table 1) which are utilized efficiently only when high cytoplasmic concentrations of the cAMP-Crp complex are available (Zhang et al., 2014).
Table 1: Growth of wild type, an IS5 insertional mutant and a non-IS5 mutant on minimal M9 agar plates supplemented with various carbon sources1,2.
To demonstrate that the Glp+ phenotype of IS^5^ mutants results solely from the IS^5^ insertional event, we carried out P1 transduction experiments to determine if the phenotypes of 2DGr, Cmr and Glp+, could be transferred together into another E. coli genetic background. In these experiments, we used two “wild type strains”, BW25113 and BW_Cat (Supplementary Table 1) (with or without the glpFK-cat fusion), as recipients. For both recipient strains, transductants were obtained using the IS^5^ insertional mutant (expressing the fused glpFK_cat operon) as donor, when plated on M9 + glycerol + 2DG ± Cm agar plates. The regulatory regions of 23 independently isolated transductants were amplified by PCR, and all were found to carry the IS^5^ element. DNA sequencing showed that IS^5^ was located in the same position and in the same orientation as described previously (Zhang and Saier, 2009a, Zhang and Saier, 2009c)). These results showed that in these mutants, IS^5^ insertion is necessary and sufficient to give rise to the 2DGr Glp+ phenotype.
Short-term and long-term evolution experiments to evaluate if IS5-mediated activation of glpFK operon expression could have evolved in wild type cells
Initially, we conducted short term evolutionary experiments (several transfers) using the ΔcyaA strain in the presence of glycerol as sole carbon source (Figure 6A), glycerol plus 0.1 mM cAMP (Figure 6B), and glycerol plus 1.0 mM cAMP (Figure 6C). In the absence of cAMP, IS5 insertional mutants appeared as the only species after 37 h of incubation with shaking. After several transfers, virtually 100% of the cells contained IS5 in the glpFK-activating site (Figure 6A). When cAMP was added at 0.1 mM, IS5 insertional mutants again appeared as the only species after a 61 h incubation with shaking. After the first transfer, virtually all cells contained IS5 (Figure 6B). When exogenous cAMP was added at 1 mM, the appearance of these mutants was strongly inhibited. As a result, after the 6th transfer, only about 20% of the population were IS5 insertional mutants (Figure 6C). These observations are consistent with the conclusion that cAMP-Crp complex inhibits IS5 insertion upstream of the glpFK operon.
Percentages of IS5 mutant populations vs the total populations during growth in M9 + glycerol ± cAMP over time using strain ΔcyaA_Cat. For the first period [up to 61 h (A and B) or 45 h (C)], time is expressed in hours. Thereafter (vertical dotted line), time is expressed in numbers of transfers where each transfer took about a day. Figures A-C show the effects of increasing cAMP concentrations: A, 0; B, 0.1 mM; C, 1 mM.
In order to conduct long-term evolutionary experiments in a wild type background, we used glpFK_cat cells in which a chloramphenicol-resistance gene was transcriptionally fused to the glpFK operon in wild type cells such that glpFK activation by IS5 insertion led simultaneously to a Glp^+^ as well as a Cm^r^ phenotype (see Materials and Methods). Prolonged incubation of glpFK_cat wild type cells under conditions analogous to those described above for the short-term ΔcyaA experiments revealed that, IS5 mutants became an appreciable fraction of the population after several generations in minimal glycerol medium with 2-deoxyglucose, with (Figure 7A) or without (Figure 7B) chloramphenicol. When chloramphenicol was present, IS5 insertional mutants first appeared after six transfers, and then continued to accumulate during the remainder of the experiment (17 transfers) at the end of which about 25% of the cells bore the IS^5^ insertion (Figure 7A). When chloramphenicol was absent, it took a little longer; insertional mutants became appreciable following the eighth transfer, and accounted for over 20% of the cells after 20 transfers (Figure 7B). These experiments show that glpFK activation by IS5 is advantageous when wild type cells are exposed to glycerol in the presence of a sugar analogue inhibitor of adenylate cyclase such as 2-deoxyglucose (Novotny et al., 1985). Thus, the process we had previously described in Δcrp and ΔcyaA mutants could have evolved in wild type cells in response to specific environmental conditions.
Percentages of IS5 insertional mutant populations versus total mutant populations over time using the “wild type” strain carrying the chromosomal glpFK-cat fusion. Cells were incubated with shaking at 30 oC in 5 ml of M9 + glycerol (0.2%) + 2DG (0.13%) plus (A) or minus (B) chloramphenicol (Cm) (60 μg/ml) in glass tubes (20 mm x 200 mm). After 2.5 days of incubation, 5 μl cultures were transferred to 5ml of the same media (1st transfer) and incubated with shaking at 30 oC. Later, every two days, 5 μl cultures were transferred to new media and grown under the same conditions. For every transfer, the cultures were diluted with carbon source-free M9 salt solution and plated onto M9 + glycerol + 2DG + Cm agar plates. After 2 days of incubation at 30 oC, 100 colonies were examined by PCR for the presence of IS5 in the glpFK control region (See Figure 5).
Discussion
Transposons (transposable elements; jumping genes) were first described by Barbara McClintock (McClintock, 1950), recipient of the 1983 Nobel Prize (Kenez, 1984, van de Putte, 1983). Initially identified in corn, transposable elements occur in virtually all living organisms, where they cause mutations that can inactivate genes, activate genes, and mediate chromosomal rearrangements (Zhang and Saier, 2011). Different types of transposons (especially retrotransposons) comprise about 30% of the human genome (Cordaux and Batzer, 2009). Why are they ubiquitous, and what are their primary functions? What is responsible for their broad occurrence in genomes of all types of living organisms? The answers to these questions are not yet in hand, but it is clear that transposons contribute to genomic instability and genetic innovation (Huang et al., 2012).
Long-terminal-repeat (LTR) retrotransposons are known to jump around within eukaryotic genomes (Curcio et al., 2015). To avoid damaging resident genes, they have been selected to integrate away from protein-coding sequences. For instance, the fission yeast LTR retrotransposon, Tf1, inserts at nucleosome-free regions in gene promoters. Jacobs et al. (Jacobs et al., 2015) recently showed that Tf1 is directed to these insertion sites by specific DNA binding proteins such as Sap1, a situation that parallels in some respects the observations reported here. Thus, regulation of transposon insertion by DNA-binding proteins may prove to be common in Nature, perhaps even ubiquitous.
Adaptive mutation, the genome-wide acceleration of mutation rate under stress conditions, is well-documented, and in some cases, the mechanisms involved are understood (Shee et al., 2011). An understanding of the basis for mutations that increase fitness, give rise to drug resistance, and enable the emergence of pathological traits in microorganisms, are also relevant to human, animal and plant health, at both the individual and the population levels (Gordo et al., 2011).
Over the last several decades, a number of mechanisms that accelerate mutagenesis under stressful conditions have been described. Among these have been those that activate cyptic operons by transposon insertion under starvation conditions where such activation is beneficial to the cell (Hall, 1999). Another example is provided by enhanced IS insertional mutations causing metal resistance in bacterial cells subjected to toxic levels of zinc (Vandecraen et al., 2016). The activation of the glpFK operon by IS5 insertion represents an adaptive mutagenic mechanism where some, but not all, molecular mechanisms leading to the activation of the operon are understood (Zhang and Saier, 2009b, Zhang and Saier, 2009d). In this paper we advance the state of knowledge of this system by showing that transposition into the upstream promoter region of glpFK is controlled independently by two defined DNA binding proteins (GlpR and the Crp-cAMP-Crp complex). We show that IS5 insertion into the glpFK promoter can be regulated by exposure to environmental toxic sugar analogues, and propose that such exposure may constitute a selective environment that favored the evolution of a gene activation mechanism that requires a specific transposition event.
In our experiments with wild type E. coli cells, we used 2-deoxyglucose (2DG) as described in this report or methyl α-glucoside (αMG) (data not presented) to lower cytoplasmic cAMP levels and to inhibit glycerol utilization (Saier, 1998, Saier, 1989, Saier, 2001, Saier et al., 1995). But are comparable non-metabolizable glucose analogues found in Nature? In fact, numerous toxic and non-metabolizable sugar analogues are synthesized by microorganisms, plants, fungi and man. They include deoxy sugars such as 2-deoxyglucose, methylated sugars, such as 3- and 6-0 methyl glucose, fluoro sugars and a variety of α- and β-glycosides such as methyl α-glucoside (He and Liu, 2002, Holst and Williamson, 2004, Kumar et al., 2013, Moller, 2010, Tantanarat et al., 2012, Saier and Ballou, 1968, Xi et al., 2014). Thus, the conditions that promote IS5 hopping into the glpFK-activating site could have evolved under the pressures of natural selection. Supporting a possible evolutionary role for transposition under starvation conditions, it was recently reported that prolonged starvation leads to significantly elevated expression of transposases in E. coli, including the insA gene, encoding the IS5 transposase (Arunasri et al., 2014).
Concluding Remarks
We have shown that the IS5-mediated glpFK-activating insertional site is a conditional transposition hotspot. It is an insertional hotspot in low cyclic AMP and high glycerol, but insertion at this site is essentially undetectable in the presence of other carbon sources, or high levels of cyclic AMP in the absence of glycerol. The experimentation described in this report explains the effect of cAMP for the first time, and provides plausible conditions under which such a mutational mechanism could have evolved in a wild type genetic background. Thus, our results demonstrate that the activated cAMP-Crp complex strongly inhibits IS^5^ hoping into the glpFK activating site when bound to its DNA-binding sites in the upstream glpFK-promoter region. Our results also showed definitively that in the lab, one can isolate these activating mutants in a wild type genetic background in the presence of glycerol and inhibitory concentrations of 2DG or α-MG that represent adverse environmental conditions.
The reference list from the paper itself. Each links out to its DOI / PubMed record.
- 1Arunasri K., Adil M., Khan P. A. & Shivaji S. 2014. Global gene expression analysis of long-term stationary phase effects in E. coli K 12 MG 1655. P Lo S One, 9, e 96701.
- 2Cairns J. & Foster P. L. 1991. Adaptive reversion of a frameshift mutation in Escherichia coli. Genetics, 128, 695–701.
- 3Cheng K. K., Lee B. S., Masuda T., Ito T., Ikeda K., Hirayama A., Deng L., Dong J., Shimizu K., Soga T., Tomita M., Palsson B. O. & Robert M. 2014. Global metabolic network reorganization by adaptive mutations allows fast growth of Escherichia coli on glycerol. Nature communications, 5, 3233.
- 4Cordaux R. & Batzer M. A. 2009. The impact of retrotransposons on human genome evolution. Nature reviews. Genetics, 10, 691–703.
- 5Curcio M. J., Lutz S. & Lesage P. 2015. The Ty 1 LTR-Retrotransposon of Budding Yeast, Saccharomyces cerevisiae. Microbiol Spectr, 3, MDNA 3-0053-2014.
- 6Datsenko K. A. & Wanner B. L. 2000 a. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A, 97, 6640–5.
- 7Datsenko K. A. & Wanner B. L. 2000 b. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences of the United States of America, 97, 6640–5.
- 8Feucht B. U. & Saier M. H., JR. 1980. Fine control of adenylate cyclase by the phosphoenolpyruvate:sugar phosphotransferase systems in Escherichia coli and Salmonella typhimurium. Journal of bacteriology, 141, 603–10.